Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8460Btlr/Mmmh
Stock Number:
067905-MU
Citation ID:
RRID:MMRRC_067905-MU
Other Names:
R8460 (G1)
Major Collection:

Strain Information

Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Smad7
Name: SMAD family member 7
Synonyms: Madh7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17131
HGNC: HGNC:6773
Homologene: 4314
Slc25a13
Name: solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 13
Synonyms: Ctrn, citrin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50799
Homologene: 22800
Nfya
Name: nuclear transcription factor-Y alpha
Synonyms: Sez10, Cbf-b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18044
HGNC: HGNC:7804
Homologene: 32114
Setd2
Name: SET domain containing 2
Synonyms: 4921524K10Rik, KMT3A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235626
Homologene: 56493
Kif1b
Name: kinesin family member 1B
Synonyms: D4Mil1e, Kif1b alpha, Kif1b beta, KIF1Bp130, KIF1Bp204, N-3 kinesin, A530096N05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16561
Homologene: 99835
Impact
Name: impact, RWD domain protein
Synonyms: E430016J11Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16210
VEGA: 18
Homologene: 5490
Zfp26
Name: zinc finger protein 26
Synonyms: mkr-3, Zfp-26, 5033428C05Rik, Zfp70, KRAB15, Zfp81-rs1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22688
Homologene: 52318
Sh3gl1
Name: SH3-domain GRB2-like 1
Synonyms: SH3P8, EEN, endophilin II, Sh3d2b, endophilin A2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20405
VEGA: 17
Homologene: 55709
Map3k12
Name: mitogen-activated protein kinase kinase kinase 12
Synonyms: Zpk, DLK, MUK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 26404
HGNC: HGNC:6851
Homologene: 4592
Arhgap23
Name: Rho GTPase activating protein 23
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 58996
Homologene: 104145
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Setd1a
Name: SET domain containing 1A
Synonyms: KMT2F
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233904
Homologene: 52251
Megf9
Name: multiple EGF-like-domains 9
Synonyms: 4933405H16Rik, Egfl5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230316
HGNC: HGNC:3234
Homologene: 18209
Ldah
Name: lipid droplet associated hydrolase
Synonyms: 1110057K04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68832
VEGA: 12
Homologene: 41453
Dock2
Name: dedicator of cyto-kinesis 2
Synonyms: MBC, CED-5, Hch
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94176
HGNC: HGNC:2988
Homologene: 37984
Adgrf5
Name: adhesion G protein-coupled receptor F5
Synonyms: 8430401C09Rik, Gpr116
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224792
VEGA: 17
Homologene: 9065
Or9s23
Name: olfactory receptor family 9 subfamily S member 23
Synonyms: GA_x6K02T2R7CC-81180849-81179878, MOR208-1, Olfr1413
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 259039
Homologene: 128165
Cd180
Name: CD180 antigen
Synonyms: RP105, Ly78
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17079
HGNC: HGNC:6726
Homologene: 4077
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: mfmi1, flamingo, EGFL2, Adgrc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Slc44a5
Name: solute carrier family 44, member 5
Synonyms: LOC242259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242259
Homologene: 72094
Abcb11
Name: ATP-binding cassette, sub-family B member 11
Synonyms: PFIC2, ABC16, PGY4, Lith1, sister of P-glycoprotein, Bsep
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Atg9b
Name: autophagy related 9B
Synonyms: LOC213948, Apg9l2, eONE, Nos3as
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 213948
Homologene: 72638
Prg4
Name: proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
Synonyms: MSF, DOL54, lubricin, SZP
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 96875
HGNC: HGNC:9364
Homologene: 137352
Catsperg2
Name: cation channel sperm associated auxiliary subunit gamma 2
Synonyms: 1700067C01Rik, CATSPERG
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76718
Homologene: 10915
Grm5
Name: glutamate receptor, metabotropic 5
Synonyms: mGluR5, Gprc1e, 6430542K11Rik, Glu5R
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108071
HGNC: HGNC:4597
Homologene: 37354
Krt81
Name: keratin 81
Synonyms: Krt2-19
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64818
VEGA: 15
HGNC: HGNC:6458
Homologene: 55645
Cep85l
Name: centrosomal protein 85-like
Synonyms: Gm9766
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100038725
VEGA: 10
Homologene: 52598
Megf6
Name: multiple EGF-like-domains 6
Synonyms: 2600001P17Rik, Egfl3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230971
HGNC: HGNC:3232
Homologene: 45412
Snx33
Name: sorting nexin 33
Synonyms: E130307J07Rik, Sh3px3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235406
VEGA: 9
Homologene: 45165
Vps33b
Name: vacuolar protein sorting 33B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233405
Homologene: 10261
Or10s1
Name: olfactory receptor family 10 subfamily S member 1
Synonyms: GA_x6K02T2PVTD-33772307-33773260, MOR223-4, Olfr982
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258853
VEGA: 9
Homologene: 17415
Sidt1
Name: SID1 transmembrane family, member 1
Synonyms: B830021E24Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320007
Homologene: 41189
Fam163a
Name: family with sequence similarity 163, member A
Synonyms: A230106N23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329274
Homologene: 18306
Olah
Name: oleoyl-ACP hydrolase
Synonyms: E230009B14Rik, Thedc1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99035
Homologene: 10136
1700067P10Rik
Name: RIKEN cDNA 1700067P10 gene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68224
VEGA: 17
Homologene: 87035
Gmnc
Name: geminin coiled-coil domain containing
Synonyms: LOC239789, LOC385639, Gm606
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239789
VEGA: 16
Homologene: 79940
Cyp21a1
Name: cytochrome P450, family 21, subfamily a, polypeptide 1
Synonyms: 21-OH, 21-hydroxylase, 21OH, Oh21-1, 21OHA, Cyp21, Oh21-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13079
Homologene: 68063
Or8b47
Name: olfactory receptor family 8 subfamily B member 47
Synonyms: GA_x6K02T2PVTD-32247224-32248163, GA_x6K02T2PVTD-32223906-32224841, MOR166-1, MOR165-1, Olfr909, Olfr911
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258873
VEGA: 9
Homologene: 74148
Or8k23
Name: olfactory receptor family 8 subfamily K member 23
Synonyms: GA_x6K02T2Q125-47827833-47826892, MOR186-2, Olfr1056
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259020
Homologene: 27328
Gpc2
Name: glypican 2 cerebroglycan
Synonyms: 2410016G05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71951
HGNC: HGNC:4450
Homologene: 17657
Marveld3
Name: MARVEL (membrane-associating) domain containing 3
Synonyms: MARVD3, 1810006A16Rik, Mrvldc3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73608
Homologene: 12504
Mcpt2
Name: mast cell protease 2
Synonyms: MMCP-2, Mcp-2, MMCP-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17225
VEGA: 14
Or51t4
Name: olfactory receptor family 51 subfamily T member 4
Synonyms: GA_x6K02T2PBJ9-5659738-5660748, MOR14-9, Olfr574
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258357
Homologene: 27137
Or7g21
Name: olfactory receptor family 7 subfamily G member 21
Synonyms: GA_x6K02T2PVTD-12857805-12858749, MOR152-3, Olfr836
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258557
HGNC: HGNC:8466
Homologene: 115507
6030458C11Rik
Name: RIKEN cDNA 6030458C11 gene
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77877
VEGA: 15
Homologene: 10149
Pou4f3
Name: POU domain, class 4, transcription factor 3
Synonyms: Brn-3.1, Brn3.1, Brn3c
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18998
HGNC: HGNC:9220
Homologene: 2023
Pcdhgb6
Name: protocadherin gamma subfamily B, 6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93703
HGNC: HGNC:8713
Homologene: 49573
Rdh5
Name: retinol dehydrogenase 5
Synonyms: cRDH
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19682
HGNC: HGNC:9940
Homologene: 2179
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CGCTCCGTGCCCCCCGCGCGCCCCGTGCCTCCCACGCGCCCCGTGCCTCCCGCAGGCTCCGTGCCCCCCGCG to CGCTCCGTGCCCCCCGCG, chromosome 1 at 63,309,570 bp
  • T to A, chromosome 1 at 92,573,546 bp
  • G to A, chromosome 1 at 150,455,941 bp
  • A to G, chromosome 1 at 156,079,966 bp
  • T to A, chromosome 2 at 3,361,725 bp
  • T to C, chromosome 2 at 69,324,037 bp
  • T to G, chromosome 2 at 86,355,854 bp
  • C to T, chromosome 3 at 108,396,777 bp
  • G to A, chromosome 3 at 154,270,030 bp
  • A to T, chromosome 4 at 70,455,971 bp
  • C to T, chromosome 4 at 101,941,227 bp
  • A to T, chromosome 4 at 145,170,439 bp
  • C to T, chromosome 4 at 149,187,620 bp
  • T to A, chromosome 4 at 154,266,177 bp
  • T to C, chromosome 5 at 24,386,968 bp
  • T to A, chromosome 5 at 94,683,931 bp
  • A to T, chromosome 5 at 138,276,629 bp
  • A to T, chromosome 6 at 6,073,513 bp
  • T to C, chromosome 7 at 29,705,319 bp
  • T to C, chromosome 7 at 80,287,869 bp
  • A to G, chromosome 7 at 87,603,041 bp
  • T to A, chromosome 7 at 102,949,324 bp
  • T to C, chromosome 7 at 127,784,120 bp
  • T to C, chromosome 8 at 109,954,408 bp
  • T to C, chromosome 9 at 19,121,692 bp
  • A to T, chromosome 9 at 20,437,077 bp
  • A to T, chromosome 9 at 38,516,630 bp
  • T to C, chromosome 9 at 40,075,057 bp
  • T to A, chromosome 9 at 56,926,192 bp
  • A to G, chromosome 9 at 110,594,270 bp
  • C to A, chromosome 10 at 53,349,217 bp
  • C to T, chromosome 10 at 128,918,267 bp
  • C to A, chromosome 11 at 34,230,825 bp
  • T to A, chromosome 11 at 97,452,371 bp
  • A to G, chromosome 12 at 8,268,548 bp
  • A to T, chromosome 12 at 113,964,436 bp
  • T to C, chromosome 13 at 102,702,846 bp
  • A to G, chromosome 14 at 56,043,744 bp
  • T to C, chromosome 15 at 12,818,459 bp
  • G to T, chromosome 15 at 101,463,612 bp
  • C to T, chromosome 15 at 102,501,597 bp
  • A to G, chromosome 16 at 19,957,031 bp
  • G to A, chromosome 16 at 26,960,454 bp
  • A to T, chromosome 16 at 44,287,342 bp
  • T to C, chromosome 17 at 34,802,870 bp
  • C to A, chromosome 17 at 43,439,808 bp
  • G to T, chromosome 17 at 48,090,329 bp
  • T to C, chromosome 17 at 48,391,946 bp
  • T to C, chromosome 17 at 56,019,321 bp
  • C to T, chromosome 18 at 12,976,507 bp
  • T to A, chromosome 18 at 37,744,225 bp
  • T to C, chromosome 18 at 42,395,988 bp
  • T to C, chromosome 18 at 75,370,897 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8460 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067905-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.