Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8460Btlr/Mmmh
Stock Number:
067905-MU
Citation ID:
RRID:MMRRC_067905-MU
Other Names:
R8460 (G1)
Major Collection:

Strain Information

Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Smad7
Name: SMAD family member 7
Synonyms: Madh7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17131
HGNC: HGNC:6773
Homologene: 4314
Slc25a13
Name: solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 13
Synonyms: Ctrn, citrin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50799
Homologene: 22800
Nfya
Name: nuclear transcription factor-Y alpha
Synonyms: Sez10, Cbf-b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18044
HGNC: HGNC:7804
Homologene: 32114
Setd2
Name: SET domain containing 2
Synonyms: 4921524K10Rik, KMT3A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235626
Homologene: 56493
Kif1b
Name: kinesin family member 1B
Synonyms: D4Mil1e, Kif1b alpha, Kif1b beta, KIF1Bp130, KIF1Bp204, N-3 kinesin, A530096N05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16561
Homologene: 99835
Impact
Name: impact, RWD domain protein
Synonyms: E430016J11Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16210
VEGA: 18
Homologene: 5490
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • CGCTCCGTGCCCCCCGCGCGCCCCGTGCCTCCCACGCGCCCCGTGCCTCCCGCAGGCTCCGTGCCCCCCGCG to CGCTCCGTGCCCCCCGCG, chromosome 1 at 63,309,570 bp
  • T to A, chromosome 1 at 92,573,546 bp
  • G to A, chromosome 1 at 150,455,941 bp
  • A to G, chromosome 1 at 156,079,966 bp
  • T to A, chromosome 2 at 3,361,725 bp
  • T to C, chromosome 2 at 69,324,037 bp
  • T to G, chromosome 2 at 86,355,854 bp
  • C to T, chromosome 3 at 108,396,777 bp
  • G to A, chromosome 3 at 154,270,030 bp
  • A to T, chromosome 4 at 70,455,971 bp
  • C to T, chromosome 4 at 101,941,227 bp
  • A to T, chromosome 4 at 145,170,439 bp
  • C to T, chromosome 4 at 149,187,620 bp
  • T to A, chromosome 4 at 154,266,177 bp
  • T to C, chromosome 5 at 24,386,968 bp
  • T to A, chromosome 5 at 94,683,931 bp
  • A to T, chromosome 5 at 138,276,629 bp
  • A to T, chromosome 6 at 6,073,513 bp
  • T to C, chromosome 7 at 29,705,319 bp
  • T to C, chromosome 7 at 80,287,869 bp
  • A to G, chromosome 7 at 87,603,041 bp
  • T to A, chromosome 7 at 102,949,324 bp
  • T to C, chromosome 7 at 127,784,120 bp
  • T to C, chromosome 8 at 109,954,408 bp
  • T to C, chromosome 9 at 19,121,692 bp
  • A to T, chromosome 9 at 20,437,077 bp
  • A to T, chromosome 9 at 38,516,630 bp
  • T to C, chromosome 9 at 40,075,057 bp
  • T to A, chromosome 9 at 56,926,192 bp
  • A to G, chromosome 9 at 110,594,270 bp
  • C to A, chromosome 10 at 53,349,217 bp
  • C to T, chromosome 10 at 128,918,267 bp
  • C to A, chromosome 11 at 34,230,825 bp
  • T to A, chromosome 11 at 97,452,371 bp
  • A to G, chromosome 12 at 8,268,548 bp
  • A to T, chromosome 12 at 113,964,436 bp
  • T to C, chromosome 13 at 102,702,846 bp
  • A to G, chromosome 14 at 56,043,744 bp
  • T to C, chromosome 15 at 12,818,459 bp
  • G to T, chromosome 15 at 101,463,612 bp
  • C to T, chromosome 15 at 102,501,597 bp
  • A to G, chromosome 16 at 19,957,031 bp
  • G to A, chromosome 16 at 26,960,454 bp
  • A to T, chromosome 16 at 44,287,342 bp
  • T to C, chromosome 17 at 34,802,870 bp
  • C to A, chromosome 17 at 43,439,808 bp
  • G to T, chromosome 17 at 48,090,329 bp
  • T to C, chromosome 17 at 48,391,946 bp
  • T to C, chromosome 17 at 56,019,321 bp
  • C to T, chromosome 18 at 12,976,507 bp
  • T to A, chromosome 18 at 37,744,225 bp
  • T to C, chromosome 18 at 42,395,988 bp
  • T to C, chromosome 18 at 75,370,897 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8460 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067905-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.