Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8495Btlr/Mmmh
Stock Number:
067937-MU
Citation ID:
RRID:MMRRC_067937-MU
Other Names:
R8495 (G1)
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Smc2
Name: structural maintenance of chromosomes 2
Synonyms: 5730502P04Rik, CAP-E, Fin16, Smc2l1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14211
Homologene: 4705
Cop1
Name: COP1, E3 ubiquitin ligase
Synonyms: Cop1, Rfwd2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26374
Homologene: 115565
Enox1
Name: ecto-NOX disulfide-thiol exchanger 1
Synonyms: D230005D02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239188
VEGA: 14
Homologene: 56793
Cdc5l
Name: cell division cycle 5-like
Synonyms: PCDC5RP, 1200002I02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71702
VEGA: 17
HGNC: HGNC:1743
Homologene: 13291
Xpo7
Name: exportin 7
Synonyms: Ranbp16, 4930506C02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 65246
VEGA: 14
Homologene: 22857
Trim23
Name: tripartite motif-containing 23
Synonyms: Arfd1, 6330516O20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 81003
HGNC: HGNC:660
Homologene: 1251
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 93,603,417 bp
  • A to T, chromosome 1 at 159,250,030 bp
  • G to A, chromosome 1 at 174,215,485 bp
  • A to T, chromosome 2 at 22,396,273 bp
  • A to G, chromosome 2 at 23,207,840 bp
  • A to G, chromosome 2 at 32,678,894 bp
  • C to T, chromosome 2 at 111,229,410 bp
  • G to A, chromosome 4 at 11,267,659 bp
  • A to G, chromosome 4 at 24,496,908 bp
  • A to T, chromosome 4 at 52,450,992 bp
  • T to G, chromosome 5 at 8,865,865 bp
  • G to T, chromosome 5 at 45,460,143 bp
  • A to G, chromosome 5 at 48,379,357 bp
  • A to T, chromosome 5 at 86,492,260 bp
  • A to T, chromosome 5 at 105,276,704 bp
  • T to C, chromosome 5 at 122,333,033 bp
  • A to T, chromosome 6 at 132,737,924 bp
  • T to C, chromosome 7 at 16,218,547 bp
  • T to G, chromosome 7 at 28,086,553 bp
  • T to C, chromosome 7 at 120,887,880 bp
  • A to G, chromosome 9 at 37,425,368 bp
  • A to G, chromosome 9 at 64,886,879 bp
  • G to T, chromosome 9 at 67,354,467 bp
  • A to G, chromosome 9 at 96,995,569 bp
  • G to A, chromosome 9 at 113,689,707 bp
  • G to A, chromosome 10 at 33,905,492 bp
  • A to T, chromosome 11 at 34,231,622 bp
  • A to G, chromosome 11 at 97,146,603 bp
  • G to A, chromosome 13 at 22,556,709 bp
  • T to C, chromosome 13 at 33,981,494 bp
  • T to C, chromosome 13 at 104,201,309 bp
  • T to C, chromosome 14 at 31,155,833 bp
  • T to C, chromosome 14 at 41,770,096 bp
  • A to G, chromosome 14 at 70,670,549 bp
  • T to C, chromosome 14 at 77,632,572 bp
  • G to T, chromosome 14 at 78,937,177 bp
  • A to G, chromosome 15 at 28,409,268 bp
  • A to G, chromosome 15 at 99,510,592 bp
  • TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,295 bp
  • G to C, chromosome 17 at 32,924,859 bp
  • G to A, chromosome 17 at 43,038,237 bp
  • A to G, chromosome 17 at 45,426,523 bp
  • T to A, chromosome 19 at 13,749,229 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8495 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067937-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.