Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8495Btlr/Mmmh
Stock Number:
067937-MU
Citation ID:
RRID:MMRRC_067937-MU
Other Names:
R8495 (G1)
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Smc2
Name: structural maintenance of chromosomes 2
Synonyms: 5730502P04Rik, CAP-E, Fin16, Smc2l1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14211
Homologene: 4705
Cop1
Name: COP1, E3 ubiquitin ligase
Synonyms: Cop1, Rfwd2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26374
Homologene: 115565
Enox1
Name: ecto-NOX disulfide-thiol exchanger 1
Synonyms: D230005D02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239188
VEGA: 14
Homologene: 56793
Cdc5l
Name: cell division cycle 5-like
Synonyms: PCDC5RP, 1200002I02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71702
VEGA: 17
HGNC: HGNC:1743
Homologene: 13291
Xpo7
Name: exportin 7
Synonyms: Ranbp16, 4930506C02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 65246
VEGA: 14
Homologene: 22857
Trim23
Name: tripartite motif-containing 23
Synonyms: Arfd1, 6330516O20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 81003
HGNC: HGNC:660
Homologene: 1251
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Tnfrsf21
Name: tumor necrosis factor receptor superfamily, member 21
Synonyms: DR6, Death receptor 6, TR7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 94185
VEGA: 17
Homologene: 8696
Pdcd6ip
Name: programmed cell death 6 interacting protein
Synonyms: Alix, AIP1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18571
HGNC: HGNC:8766
Homologene: 22614
Mms22l
Name: MMS22-like, DNA repair protein
Synonyms: F730047E07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212377
Homologene: 18874
Robo3
Name: roundabout guidance receptor 3
Synonyms: Rig-1, Rbig1, Robo3b, Robo3a, Rig1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19649
Homologene: 32119
Eng
Name: endoglin
Synonyms: CD105, Endo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13805
HGNC: HGNC:3349
Homologene: 92
Dpy19l4
Name: dpy-19 like 4
Synonyms: LOC381510, Narg3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381510
Homologene: 18773
Dock2
Name: dedicator of cyto-kinesis 2
Synonyms: MBC, CED-5, Hch
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 94176
HGNC: HGNC:2988
Homologene: 37984
Tbkbp1
Name: TBK1 binding protein 1
Synonyms: 3110043L15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73174
Homologene: 8820
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1154Clo, b2b1134Clo, b2b1537Clo, b2b1565Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20739
Homologene: 74460
Myo3a
Name: myosin IIIA
Synonyms: 9030416P08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 667663
HGNC: HGNC:7601
Homologene: 49486
Dennd4a
Name: DENN domain containing 4A
Synonyms: F730015K02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102442
VEGA: 9
Homologene: 55933
Nqo2
Name: N-ribosyldihydronicotinamide quinone reductase 2
Synonyms: NRH: quinone oxidoreductase, Ox-2, Ox2, Nmor2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18105
VEGA: 13
HGNC: HGNC:7856
Homologene: 696
Rad9b
Name: RAD9 checkpoint clamp component B
Synonyms: A630082N15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231724
Homologene: 17006
Vmn1r204
Name: vomeronasal 1 receptor 204
Synonyms: Gm11301
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 632793
Homologene: 110880
Farp2
Name: FERM, RhoGEF and pleckstrin domain protein 2
Synonyms: Fir, D030026M03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227377
Homologene: 8877
Abcb1b
Name: ATP-binding cassette, sub-family B member 1B
Synonyms: Mdr1, Mdr1b, mdr, Pgy1, Pgy-1, Abcb1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18669
HGNC: HGNC:40
Homologene: 69084
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 4932416F07Rik, 1300010F03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Stab1
Name: stabilin 1
Synonyms: MS-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 192187
Homologene: 9035
Rsph4a
Name: radial spoke head 4 homolog A (Chlamydomonas)
Synonyms: Rshl3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 212892
Homologene: 71779
Cyp4f13
Name: cytochrome P450, family 4, subfamily f, polypeptide 13
Synonyms: P450 CYP4F13, leukotriene B4 omega hydroxylase, 0610030I10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 170716
HGNC: HGNC:2648
Homologene: 73902
Or10q1
Name: olfactory receptor family 10 subfamily Q member 1
Synonyms: GA_x6K02T2RE5P-4082427-4083374, MOR266-1, Olfr1494
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258992
Homologene: 64855
Dhx34
Name: DExH-box helicase 34
Synonyms: Ddx34, 1200013B07Rik, 1810012L18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71723
Homologene: 69171
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 215384
Homologene: 68369
Spsb4
Name: splA/ryanodine receptor domain and SOCS box containing 4
Synonyms: D030068E18Rik, Ssb4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 211949
Homologene: 25315
Tmprss11g
Name: transmembrane protease, serine 11g
Synonyms: 9930032O22Rik, Desc4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320454
Homologene: 82239
Eef2k
Name: eukaryotic elongation factor-2 kinase
Synonyms: eEF-2K
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13631
Homologene: 7299
Ankrd68
Name: ankyrin repeat domain 68
Synonyms: 4931423N10Rik, Potegl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70981
Homologene: 86765
Tas2r115
Name: taste receptor, type 2, member 115
Synonyms: Tas2r15, mGR15, mt2r49, T2R15
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353325
Potefam1
Name: POTE ankyrin domain family member 1
Synonyms: Pote1, 4930430A15Rik, A26c3, Potea
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67575
Homologene: 69410
Faim2
Name: Fas apoptotic inhibitory molecule 2
Synonyms: NMP25, 2900002L20Rik, lifeguard, Lfg, Tmbim2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72393
VEGA: 15
Homologene: 8192
Clrn2
Name: clarin 2
Synonyms: EG624224, mpc169H
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 624224
Homologene: 84057
Gm43302
Name: predicted gene 43302
Type: Gene
Species: Mouse
Chromosome: 5
Gm47189
Name: predicted gene, 47189
Type: Gene
Species: Mouse
Chromosome: 14
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 93,603,417 bp
  • A to T, chromosome 1 at 159,250,030 bp
  • G to A, chromosome 1 at 174,215,485 bp
  • A to T, chromosome 2 at 22,396,273 bp
  • A to G, chromosome 2 at 23,207,840 bp
  • A to G, chromosome 2 at 32,678,894 bp
  • C to T, chromosome 2 at 111,229,410 bp
  • G to A, chromosome 4 at 11,267,659 bp
  • A to G, chromosome 4 at 24,496,908 bp
  • A to T, chromosome 4 at 52,450,992 bp
  • T to G, chromosome 5 at 8,865,865 bp
  • G to T, chromosome 5 at 45,460,143 bp
  • A to G, chromosome 5 at 48,379,357 bp
  • A to T, chromosome 5 at 86,492,260 bp
  • A to T, chromosome 5 at 105,276,704 bp
  • T to C, chromosome 5 at 122,333,033 bp
  • A to T, chromosome 6 at 132,737,924 bp
  • T to C, chromosome 7 at 16,218,547 bp
  • T to G, chromosome 7 at 28,086,553 bp
  • T to C, chromosome 7 at 120,887,880 bp
  • A to G, chromosome 9 at 37,425,368 bp
  • A to G, chromosome 9 at 64,886,879 bp
  • G to T, chromosome 9 at 67,354,467 bp
  • A to G, chromosome 9 at 96,995,569 bp
  • G to A, chromosome 9 at 113,689,707 bp
  • G to A, chromosome 10 at 33,905,492 bp
  • A to T, chromosome 11 at 34,231,622 bp
  • A to G, chromosome 11 at 97,146,603 bp
  • G to A, chromosome 13 at 22,556,709 bp
  • T to C, chromosome 13 at 33,981,494 bp
  • T to C, chromosome 13 at 104,201,309 bp
  • T to C, chromosome 14 at 31,155,833 bp
  • T to C, chromosome 14 at 41,770,096 bp
  • A to G, chromosome 14 at 70,670,549 bp
  • T to C, chromosome 14 at 77,632,572 bp
  • G to T, chromosome 14 at 78,937,177 bp
  • A to G, chromosome 15 at 28,409,268 bp
  • A to G, chromosome 15 at 99,510,592 bp
  • TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCAGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to TCCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,295 bp
  • G to C, chromosome 17 at 32,924,859 bp
  • G to A, chromosome 17 at 43,038,237 bp
  • A to G, chromosome 17 at 45,426,523 bp
  • T to A, chromosome 19 at 13,749,229 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8495 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067937-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.