Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8542Btlr/Mmmh
Stock Number:
068507-MU
Citation ID:
RRID:MMRRC_068507-MU
Other Names:
R8542 (G1)
Major Collection:

Strain Information

Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Rbms1
Name: RNA binding motif, single stranded interacting protein 1
Synonyms: YC1, MSSP-3, MSSP-2, MSSP-1, 2600014B10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56878
HGNC: HGNC:9907
Homologene: 9640
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Morc3
Name: microrchidia 3
Synonyms: 1110051N18Rik, D16Jhu32e, 1110051N18Rik, Zcwcc3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 338467
Homologene: 32257
Trpc4ap
Name: transient receptor potential cation channel, subfamily C, member 4 associated protein
Synonyms: Trp4-associated protein TAP1, Trrp4ap, D2Ertd113e, 4833429F06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56407
Homologene: 9224
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 21,479,424 bp
  • C to T, chromosome 1 at 34,192,607 bp
  • A to G, chromosome 1 at 34,557,886 bp
  • C to T, chromosome 1 at 71,309,888 bp
  • A to T, chromosome 1 at 134,605,774 bp
  • T to C, chromosome 1 at 135,364,483 bp
  • T to A, chromosome 1 at 136,468,757 bp
  • T to A, chromosome 1 at 193,194,543 bp
  • A to G, chromosome 2 at 30,472,936 bp
  • T to G, chromosome 2 at 31,011,624 bp
  • T to A, chromosome 2 at 32,619,501 bp
  • A to C, chromosome 2 at 60,781,921 bp
  • T to C, chromosome 2 at 150,586,465 bp
  • G to C, chromosome 2 at 155,692,212 bp
  • A to G, chromosome 2 at 155,799,714 bp
  • A to G, chromosome 3 at 96,682,037 bp
  • A to G, chromosome 3 at 109,503,471 bp
  • A to T, chromosome 3 at 115,122,547 bp
  • A to T, chromosome 4 at 44,570,071 bp
  • T to A, chromosome 4 at 63,321,425 bp
  • CCCCCACCTCCACAGACCCCA to CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA, chromosome 4 at 141,466,828 bp
  • A to G, chromosome 4 at 156,241,730 bp
  • A to C, chromosome 5 at 148,303,598 bp
  • C to A, chromosome 6 at 30,497,238 bp
  • T to C, chromosome 6 at 39,627,759 bp
  • G to T, chromosome 6 at 48,597,345 bp
  • A to G, chromosome 6 at 121,657,410 bp
  • A to T, chromosome 6 at 130,333,133 bp
  • T to A, chromosome 7 at 4,784,158 bp
  • A to T, chromosome 7 at 96,811,932 bp
  • A to G, chromosome 7 at 102,614,665 bp
  • C to A, chromosome 7 at 120,817,914 bp
  • C to A, chromosome 7 at 127,611,192 bp
  • T to C, chromosome 7 at 128,080,261 bp
  • T to A, chromosome 8 at 21,288,163 bp
  • C to A, chromosome 8 at 70,713,871 bp
  • G to T, chromosome 9 at 49,508,598 bp
  • A to T, chromosome 9 at 65,278,123 bp
  • C to T, chromosome 9 at 80,404,798 bp
  • A to G, chromosome 10 at 60,730,622 bp
  • T to A, chromosome 10 at 81,338,221 bp
  • C to A, chromosome 11 at 29,132,773 bp
  • A to G, chromosome 11 at 43,230,381 bp
  • A to G, chromosome 11 at 105,917,008 bp
  • G to T, chromosome 11 at 115,429,484 bp
  • A to G, chromosome 12 at 87,431,505 bp
  • G to T, chromosome 13 at 6,581,521 bp
  • C to T, chromosome 15 at 76,110,119 bp
  • G to T, chromosome 16 at 93,847,431 bp
  • A to G, chromosome 17 at 24,735,780 bp
  • A to G, chromosome 17 at 34,614,269 bp
  • G to A, chromosome 17 at 35,144,358 bp
  • T to C, chromosome 17 at 43,624,892 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • A to G, chromosome 19 at 55,291,827 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8542 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068507-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.