Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8542Btlr/Mmmh
Stock Number:
068507-MU
Citation ID:
RRID:MMRRC_068507-MU
Other Names:
R8542 (G1)
Major Collection:

Strain Information

Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Rbms1
Name: RNA binding motif, single stranded interacting protein 1
Synonyms: YC1, MSSP-3, MSSP-2, MSSP-1, 2600014B10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56878
HGNC: HGNC:9907
Homologene: 9640
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Morc3
Name: microrchidia 3
Synonyms: 1110051N18Rik, D16Jhu32e, 1110051N18Rik, Zcwcc3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 338467
Homologene: 32257
Trpc4ap
Name: transient receptor potential cation channel, subfamily C, member 4 associated protein
Synonyms: Trp4-associated protein TAP1, Trrp4ap, D2Ertd113e, 4833429F06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56407
Homologene: 9224
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: c-Cbl-associated protein, CAP, Sh3d5, 9530001P15Rik, 2310065E01Rik, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Braf
Name: Braf transforming gene
Synonyms: Braf-2, Braf2, 9930012E13Rik, D6Ertd631e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109880
HGNC: HGNC:1097
Homologene: 3197
Tanc2
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms: 5730590C14Rik, 3526402J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77097
Homologene: 64680
Zbtb17
Name: zinc finger and BTB domain containing 17
Synonyms: mZ13, Miz1, Zfp100
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22642
Homologene: 2575
Kctd2
Name: potassium channel tetramerisation domain containing 2
Synonyms: 2310012I15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70382
Homologene: 82389
Ncam1
Name: neural cell adhesion molecule 1
Synonyms: CD56, NCAM-1, NCAM-120, NCAM-140, NCAM-180, E-NCAM, NCAM
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17967
HGNC: HGNC:7656
Homologene: 40754
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Acsl5
Name: acyl-CoA synthetase long-chain family member 5
Synonyms: 1700030F05Rik, Facl5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433256
VEGA: 19
Homologene: 69208
Egfl8
Name: EGF-like domain 8
Synonyms: NG3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81701
Homologene: 36473
Olfm3
Name: olfactomedin 3
Synonyms: optimedin, B230206G02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229759
Homologene: 17103
Pfkp
Name: phosphofructokinase, platelet
Synonyms: PFK-C, 1200015H23Rik, 9330125N24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56421
HGNC: HGNC:8878
Homologene: 20579
Slc29a3
Name: solute carrier family 29 (nucleoside transporters), member 3
Synonyms: Ent3, 4933435C21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71279
Homologene: 56805
Gipc3
Name: GIPC PDZ domain containing family, member 3
Synonyms: Gipc3, Rgs19ip3, Ahl5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209047
Homologene: 77068
Cilp
Name: cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Synonyms: C130036G17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214425
HGNC: HGNC:1980
Homologene: 2679
Ankrd35
Name: ankyrin repeat domain 35
Synonyms: 4732436F15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213121
Homologene: 16977
Klra3
Name: killer cell lectin-like receptor, subfamily A, member 3
Synonyms: 5E6, Ly49C, Nk-2, Ly49c, NK-2.1, Nk2.1, Nk2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16634
Homologene: 110821
Col27a1
Name: collagen, type XXVII, alpha 1
Synonyms: 5730512J02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 373864
Homologene: 69400
Tmem209
Name: transmembrane protein 209
Synonyms: 2700094F01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72649
Homologene: 18021
Zfp629
Name: zinc finger protein 629
Synonyms: 9330199A09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320683
Homologene: 65318
Impg1
Name: interphotoreceptor matrix proteoglycan 1
Synonyms: IMP150, SPACR, A930015H12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 63859
HGNC: HGNC:6055
Homologene: 1201
A2m
Name: alpha-2-macroglobulin
Synonyms: A2mp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232345
HGNC: HGNC:7
Homologene: 37248
Atp10b
Name: ATPase, class V, type 10B
Synonyms: 5930426O13Rik, 9030605H24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319767
Homologene: 70969
St6galnac6
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Synonyms: ST6GalNAcVI, Siat7f
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50935
Homologene: 8390
Mtus2
Name: microtubule associated tumor suppressor candidate 2
Synonyms: 5730592G18Rik, A730013O20Rik, C130038G02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77521
Homologene: 78141
Kif14
Name: kinesin family member 14
Synonyms: N-3 kinesin, D1Ertd367e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381293
Homologene: 8916
Traf3ip3
Name: TRAF3 interacting protein 3
Synonyms: 6030423D04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215243
Homologene: 11885
Usp20
Name: ubiquitin specific peptidase 20
Synonyms: 1700055M05Rik, Vdu2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74270
Homologene: 4861
Bag6
Name: BCL2-associated athanogene 6
Synonyms: D17H6S52E, G3, 2410045D21Rik, Scythe, Bat3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224727
Homologene: 3409
Prss40
Name: serine protease 40
Synonyms: Tesp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21756
Homologene: 69043
Pnpt1
Name: polyribonucleotide nucleotidyltransferase 1
Synonyms: PNPase, polynucleotide phosphorylase, 1200003F12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71701
Homologene: 12404
Repin1
Name: replication initiator 1
Synonyms: AP4, E430037F08Rik, Zfp464
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58887
Homologene: 22810
Pax5
Name: paired box 5
Synonyms: Pax-5, EBB-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18507
HGNC: HGNC:8619
Homologene: 56419
Vav3
Name: vav 3 oncogene
Synonyms: A530094I06Rik, Idd18.1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 57257
Homologene: 38143
Lmod1
Name: leiomodin 1 (smooth muscle)
Synonyms: 64kD D1, 1D, D1, SM-Lmod, 9530015K06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 93689
HGNC: HGNC:6647
Homologene: 8118
Mmp24
Name: matrix metallopeptidase 24
Synonyms: MT5-MMP, Membrane type 5-MMP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17391
HGNC: HGNC:7172
Homologene: 21331
Kcnq5
Name: potassium voltage-gated channel, subfamily Q, member 5
Synonyms: 9230107O05Rik, D1Mgi1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226922
HGNC: HGNC:6299
Homologene: 28270
Apmap
Name: adipocyte plasma membrane associated protein
Synonyms: 2310001A20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71881
Homologene: 41380
Alkbh1
Name: alkB homolog 1, histone H2A dioxygenase
Synonyms: alkB, Alkbh, Nrp
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211064
Homologene: 4393
Tmem190
Name: transmembrane protein 190
Synonyms: 4930572D21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78052
Homologene: 44548
Rpl3l
Name: ribosomal protein L3-like
Synonyms: 1110057H16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66211
Homologene: 68434
Or52m2
Name: olfactory receptor family 52 subfamily M member 2
Synonyms: GA_x6K02T2PBJ9-5333671-5332712, MOR25-2, Olfr553
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233578
Homologene: 17194
Ier5l
Name: immediate early response 5-like
Synonyms: 2610524G09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72500
Homologene: 69468
Noc2l
Name: NOC2 like nucleolar associated transcriptional repressor
Synonyms: NIR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 57741
VEGA: 4
Homologene: 6980
Sdr42e2
Name: short chain dehydrogenase/reductase family 42E, member 2
Synonyms: Gm5737
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 436008
Homologene: 119224
Defa3
Name: defensin, alpha, 3
Synonyms: Defcr-3, Defcr3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13237
HGNC: HGNC:2764
Homologene: 113382
Iqcn
Name: IQ motif containing N
Synonyms: Gm16486
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 637079
Homologene: 141171
Gm49368
Name: predicted gene, 49368
Type: Gene
Species: Mouse
Chromosome: 7
Eppk1
Name: epiplakin 1
Synonyms: EPIPL1, EPPK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223650
VEGA: 15
Homologene: 20006
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 21,479,424 bp
  • C to T, chromosome 1 at 34,192,607 bp
  • A to G, chromosome 1 at 34,557,886 bp
  • C to T, chromosome 1 at 71,309,888 bp
  • A to T, chromosome 1 at 134,605,774 bp
  • T to C, chromosome 1 at 135,364,483 bp
  • T to A, chromosome 1 at 136,468,757 bp
  • T to A, chromosome 1 at 193,194,543 bp
  • A to G, chromosome 2 at 30,472,936 bp
  • T to G, chromosome 2 at 31,011,624 bp
  • T to A, chromosome 2 at 32,619,501 bp
  • A to C, chromosome 2 at 60,781,921 bp
  • T to C, chromosome 2 at 150,586,465 bp
  • G to C, chromosome 2 at 155,692,212 bp
  • A to G, chromosome 2 at 155,799,714 bp
  • A to G, chromosome 3 at 96,682,037 bp
  • A to G, chromosome 3 at 109,503,471 bp
  • A to T, chromosome 3 at 115,122,547 bp
  • A to T, chromosome 4 at 44,570,071 bp
  • T to A, chromosome 4 at 63,321,425 bp
  • CCCCCACCTCCACAGACCCCA to CCCCCACCTCCACAGACCCCACCTCCACAGACCCCA, chromosome 4 at 141,466,828 bp
  • A to G, chromosome 4 at 156,241,730 bp
  • A to C, chromosome 5 at 148,303,598 bp
  • C to A, chromosome 6 at 30,497,238 bp
  • T to C, chromosome 6 at 39,627,759 bp
  • G to T, chromosome 6 at 48,597,345 bp
  • A to G, chromosome 6 at 121,657,410 bp
  • A to T, chromosome 6 at 130,333,133 bp
  • T to A, chromosome 7 at 4,784,158 bp
  • A to T, chromosome 7 at 96,811,932 bp
  • A to G, chromosome 7 at 102,614,665 bp
  • C to A, chromosome 7 at 120,817,914 bp
  • C to A, chromosome 7 at 127,611,192 bp
  • T to C, chromosome 7 at 128,080,261 bp
  • T to A, chromosome 8 at 21,288,163 bp
  • C to A, chromosome 8 at 70,713,871 bp
  • G to T, chromosome 9 at 49,508,598 bp
  • A to T, chromosome 9 at 65,278,123 bp
  • C to T, chromosome 9 at 80,404,798 bp
  • A to G, chromosome 10 at 60,730,622 bp
  • T to A, chromosome 10 at 81,338,221 bp
  • C to A, chromosome 11 at 29,132,773 bp
  • A to G, chromosome 11 at 43,230,381 bp
  • A to G, chromosome 11 at 105,917,008 bp
  • G to T, chromosome 11 at 115,429,484 bp
  • A to G, chromosome 12 at 87,431,505 bp
  • G to T, chromosome 13 at 6,581,521 bp
  • C to T, chromosome 15 at 76,110,119 bp
  • G to T, chromosome 16 at 93,847,431 bp
  • A to G, chromosome 17 at 24,735,780 bp
  • A to G, chromosome 17 at 34,614,269 bp
  • G to A, chromosome 17 at 35,144,358 bp
  • T to C, chromosome 17 at 43,624,892 bp
  • G to C, chromosome 19 at 40,376,800 bp
  • A to G, chromosome 19 at 55,291,827 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8542 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068507-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.