Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8547Btlr/Mmmh
Stock Number:
068512-MU
Citation ID:
RRID:MMRRC_068512-MU
Other Names:
R8547 (G1)
Major Collection:

Strain Information

Tiparp
Name: TCDD-inducible poly(ADP-ribose) polymerase
Synonyms: DDF1, PARP-7, PARP7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99929
Homologene: 9167
Dgka
Name: diacylglycerol kinase, alpha
Synonyms: Dagk1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13139
VEGA: 10
HGNC: HGNC:2849
Homologene: 1028
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Ptcd2
Name: pentatricopeptide repeat domain 2
Synonyms: 1190005P08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68927
VEGA: 13
Homologene: 11695
Ago3
Name: argonaute RISC catalytic subunit 3
Synonyms: argonaute 3, eIF2C3, C130014L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214150
Homologene: 49799
Nufip2
Name: nuclear FMR1 interacting protein 2
Synonyms: 9530056D24Rik, 1110001M19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68564
Homologene: 10808
Caprin1
Name: cell cycle associated protein 1
Synonyms: MMGPIP137, Gpiap1, caprin-1, RNG105
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 53872
HGNC: HGNC:6743
Homologene: 4310
Ccdc18
Name: coiled-coil domain containing 18
Synonyms: 1700021E15Rik, 4932411G06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73254
Homologene: 35455
Ipo7
Name: importin 7
Synonyms: RanBP7, Imp7, A330055O14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233726
HGNC: HGNC:9852
Homologene: 4659
Fam193b
Name: family with sequence similarity 193, member B
Synonyms: IRIZIO
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212483
VEGA: 13
Homologene: 130095
Topbp1
Name: topoisomerase (DNA) II binding protein 1
Synonyms: D430026L04Rik, 2810429C13Rik, 1110031N14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235559
Homologene: 38262
Zzef1
Name: zinc finger, ZZ-type with EF hand domain 1
Synonyms: 8430405D05Rik, C130099L13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195018
Homologene: 9027
Psen1
Name: presenilin 1
Synonyms: S182, PS1, PS-1, presenilin-1, Ad3h
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19164
VEGA: 12
HGNC: HGNC:9508
Homologene: 7186
Zbtb21
Name: zinc finger and BTB domain containing 21
Synonyms: Znf295, 5430437K12Rik, B430213I24Rik, Zfp295
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114565
VEGA: 16
Homologene: 10799
Unc45a
Name: unc-45 myosin chaperone A
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101869
Homologene: 32423
Spag9
Name: sperm associated antigen 9
Synonyms: 4733401I23Rik, syd1, 4831406C20Rik, Mapk8ip4, JIP4, 3110018C07Rik, JLP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70834
Homologene: 2954
Psmg2
Name: proteasome (prosome, macropain) assembly chaperone 2
Synonyms: 1700017I17Rik, Clast3, Tnfsf5ip1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 107047
VEGA: 18
Homologene: 41354
Setd1a
Name: SET domain containing 1A
Synonyms: KMT2F
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233904
Homologene: 52251
Mcm6
Name: minichromosome maintenance complex component 6
Synonyms: Mcmd6, D1Wsu22e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17219
HGNC: HGNC:6949
Homologene: 4322
Ssh2
Name: slingshot protein phosphatase 2
Synonyms: SSH-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237860
Homologene: 14116
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: LOC381127, D930044O18Rik, D430002O22Rik, C230079D11Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211961
Homologene: 19371
Robo4
Name: roundabout guidance receptor 4
Synonyms: 1200012D01Rik, Magic roundabout
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74144
Homologene: 10397
Fgd2
Name: FYVE, RhoGEF and PH domain containing 2
Synonyms: tcs-2, Tcd-2, tcs2, Tcd2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26382
HGNC: HGNC:3664
Homologene: 8438
Abca3
Name: ATP-binding cassette, sub-family A member 3
Synonyms: ABC-C, Abc3, 1810036E22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27410
HGNC: HGNC:33
Homologene: 37437
Adamtsl3
Name: ADAMTS-like 3
Synonyms: punctin-2, 9230119C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269959
Homologene: 18912
Clspn
Name: claspin
Synonyms: E130314M08Rik, C85083
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269582
Homologene: 11138
Ptchd4
Name: patched domain containing 4
Synonyms: 3110082D06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627626
VEGA: 17
Homologene: 78322
Vmn2r85
Name: vomeronasal 2, receptor 85
Synonyms: EG623734
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 623734
Homologene: 129606
Hltf
Name: helicase-like transcription factor
Synonyms: P113, Snf2l3, Smarca3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20585
Homologene: 30136
Col4a2
Name: collagen, type IV, alpha 2
Synonyms: Col4a-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12827
HGNC: HGNC:2203
Homologene: 1390
Gtdc1
Name: glycosyltransferase-like domain containing 1
Synonyms: E330008O22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227835
Homologene: 32590
Aldh1a7
Name: aldehyde dehydrogenase family 1, subfamily A7
Synonyms: Aldh-pb, Ahd2-like
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 26358
HGNC: HGNC:402
Homologene: 137245
Fmo5
Name: flavin containing monooxygenase 5
Synonyms: 5033418D19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14263
HGNC: HGNC:3773
Homologene: 68185
Nsd3
Name: nuclear receptor binding SET domain protein 3
Synonyms: WHISTLE, Whsc1l1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234135
Homologene: 56960
Npbwr1
Name: neuropeptides B/W receptor 1
Synonyms: Gpr7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226304
HGNC: HGNC:4522
Homologene: 21096
Lats1
Name: large tumor suppressor
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16798
VEGA: 10
HGNC: HGNC:6514
Homologene: 55843
Krt16
Name: keratin 16
Synonyms: K16, Krt1-16
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16666
HGNC: HGNC:6423
Homologene: 21145
Or1e23
Name: olfactory receptor family 1 subfamily E member 23
Synonyms: GA_x6K02T2P1NL-3676608-3675670, MOR135-14, MOR135-31_p, Olfr382
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258435
Homologene: 17252
Or10d4c
Name: olfactory receptor family 10 subfamily D member 4C
Synonyms: GA_x6K02T2PVTD-33343617-33344561, MOR224-5, Olfr961
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258497
VEGA: 9
Homologene: 74020
Vmn2r95
Name: vomeronasal 2, receptor 95
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328759
Homologene: 115024
Ankrd68
Name: ankyrin repeat domain 68
Synonyms: 4931423N10Rik, Potegl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70981
Homologene: 86765
Catsperb
Name: cation channel sperm associated auxiliary subunit beta
Synonyms: 4932415G16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 271036
VEGA: 12
Homologene: 81904
Lrrc69
Name: leucine rich repeat containing 69
Synonyms: 1700034K16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73314
Homologene: 78018
Adamts14
Name: ADAM metallopeptidase with thrombospondin type 1 motif 14
Synonyms: TS14, Adamts-14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237360
Homologene: 16383
Ccn6
Name: cellular communication network factor 6
Synonyms: LOC327743, CCN6, Wisp3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 327743
VEGA: 10
Homologene: 77038
Hepacam
Name: hepatocyte cell adhesion molecule
Synonyms: 2900042E01Rik, Glialcam
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72927
Homologene: 17652
Cracd
Name: capping protein inhibiting regulator of actin
Synonyms: C530008M17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320827
Homologene: 136278
Slc35g3
Name: solute carrier family 35, member G3
Synonyms: Amac1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56293
Homologene: 89413
Runx3
Name: runt related transcription factor 3
Synonyms: AML2, Cbfa3, Rx3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12399
Homologene: 37914
Fn3k
Name: fructosamine 3 kinase
Synonyms: 2310074G21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 63828
Homologene: 23336
Cfl2
Name: cofilin 2, muscle
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12632
VEGA: 12
HGNC: HGNC:1875
Homologene: 129115
Eppk1
Name: epiplakin 1
Synonyms: EPIPL1, EPPK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223650
VEGA: 15
Homologene: 20006
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 5,917,227 bp
  • G to A, chromosome 1 at 60,746,522 bp
  • C to T, chromosome 1 at 128,345,948 bp
  • A to T, chromosome 2 at 23,230,123 bp
  • A to G, chromosome 2 at 44,788,981 bp
  • G to T, chromosome 2 at 103,769,517 bp
  • T to C, chromosome 3 at 20,098,127 bp
  • T to C, chromosome 3 at 65,546,377 bp
  • C to A, chromosome 3 at 97,651,495 bp
  • T to C, chromosome 4 at 14,704,014 bp
  • T to C, chromosome 4 at 126,370,316 bp
  • T to A, chromosome 4 at 126,561,816 bp
  • T to C, chromosome 4 at 135,171,144 bp
  • GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG to GCGCGAGGCCGAGAGGCAGG, chromosome 5 at 76,856,954 bp
  • A to G, chromosome 5 at 108,197,859 bp
  • A to T, chromosome 5 at 146,528,298 bp
  • A to T, chromosome 7 at 80,326,092 bp
  • C to T, chromosome 7 at 82,428,413 bp
  • T to G, chromosome 7 at 110,052,793 bp
  • T to C, chromosome 7 at 127,796,504 bp
  • A to G, chromosome 8 at 11,429,305 bp
  • T to C, chromosome 8 at 25,694,784 bp
  • T to C, chromosome 9 at 37,367,753 bp
  • C to T, chromosome 9 at 37,404,378 bp
  • C to T, chromosome 9 at 39,647,502 bp
  • T to A, chromosome 9 at 67,945,566 bp
  • C to T, chromosome 9 at 103,336,065 bp
  • T to C, chromosome 10 at 7,712,849 bp
  • T to A, chromosome 10 at 39,151,198 bp
  • T to G, chromosome 10 at 61,271,219 bp
  • A to T, chromosome 10 at 128,721,012 bp
  • T to C, chromosome 10 at 130,425,442 bp
  • T to C, chromosome 11 at 69,761,620 bp
  • T to G, chromosome 11 at 72,844,441 bp
  • T to C, chromosome 11 at 73,516,614 bp
  • T to A, chromosome 11 at 77,449,707 bp
  • T to C, chromosome 11 at 77,692,565 bp
  • T to A, chromosome 11 at 94,122,821 bp
  • G to A, chromosome 11 at 100,246,257 bp
  • T to C, chromosome 11 at 121,450,161 bp
  • A to T, chromosome 12 at 54,861,613 bp
  • T to C, chromosome 12 at 83,714,856 bp
  • T to C, chromosome 12 at 101,446,046 bp
  • A to G, chromosome 13 at 55,550,304 bp
  • A to C, chromosome 13 at 99,332,954 bp
  • C to T, chromosome 15 at 76,109,049 bp
  • C to A, chromosome 16 at 97,952,115 bp
  • G to A, chromosome 17 at 18,443,899 bp
  • T to C, chromosome 17 at 24,397,500 bp
  • C to T, chromosome 17 at 29,364,960 bp
  • A to C, chromosome 17 at 42,502,621 bp
  • T to C, chromosome 18 at 22,522,772 bp
  • T to A, chromosome 18 at 67,646,007 bp
  • A to G, chromosome 19 at 20,714,703 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8547 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068512-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.