Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8547Btlr/Mmmh
Stock Number:
068512-MU
Citation ID:
RRID:MMRRC_068512-MU
Other Names:
R8547 (G1)
Major Collection:

Strain Information

Tiparp
Name: TCDD-inducible poly(ADP-ribose) polymerase
Synonyms: DDF1, PARP-7, PARP7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99929
Homologene: 9167
Dgka
Name: diacylglycerol kinase, alpha
Synonyms: Dagk1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13139
VEGA: 10
HGNC: HGNC:2849
Homologene: 1028
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Ptcd2
Name: pentatricopeptide repeat domain 2
Synonyms: 1190005P08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68927
VEGA: 13
Homologene: 11695
Ago3
Name: argonaute RISC catalytic subunit 3
Synonyms: argonaute 3, eIF2C3, C130014L07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214150
Homologene: 49799
Nufip2
Name: nuclear FMR1 interacting protein 2
Synonyms: 9530056D24Rik, 1110001M19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68564
Homologene: 10808
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 5,917,227 bp
  • G to A, chromosome 1 at 60,746,522 bp
  • C to T, chromosome 1 at 128,345,948 bp
  • A to T, chromosome 2 at 23,230,123 bp
  • A to G, chromosome 2 at 44,788,981 bp
  • G to T, chromosome 2 at 103,769,517 bp
  • T to C, chromosome 3 at 20,098,127 bp
  • T to C, chromosome 3 at 65,546,377 bp
  • C to A, chromosome 3 at 97,651,495 bp
  • T to C, chromosome 4 at 14,704,014 bp
  • T to C, chromosome 4 at 126,370,316 bp
  • T to A, chromosome 4 at 126,561,816 bp
  • T to C, chromosome 4 at 135,171,144 bp
  • GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG to GCGCGAGGCCGAGAGGCAGG, chromosome 5 at 76,856,954 bp
  • A to G, chromosome 5 at 108,197,859 bp
  • A to T, chromosome 5 at 146,528,298 bp
  • A to T, chromosome 7 at 80,326,092 bp
  • C to T, chromosome 7 at 82,428,413 bp
  • T to G, chromosome 7 at 110,052,793 bp
  • T to C, chromosome 7 at 127,796,504 bp
  • A to G, chromosome 8 at 11,429,305 bp
  • T to C, chromosome 8 at 25,694,784 bp
  • T to C, chromosome 9 at 37,367,753 bp
  • C to T, chromosome 9 at 37,404,378 bp
  • C to T, chromosome 9 at 39,647,502 bp
  • T to A, chromosome 9 at 67,945,566 bp
  • C to T, chromosome 9 at 103,336,065 bp
  • T to C, chromosome 10 at 7,712,849 bp
  • T to A, chromosome 10 at 39,151,198 bp
  • T to G, chromosome 10 at 61,271,219 bp
  • A to T, chromosome 10 at 128,721,012 bp
  • T to C, chromosome 10 at 130,425,442 bp
  • T to C, chromosome 11 at 69,761,620 bp
  • T to G, chromosome 11 at 72,844,441 bp
  • T to C, chromosome 11 at 73,516,614 bp
  • T to A, chromosome 11 at 77,449,707 bp
  • T to C, chromosome 11 at 77,692,565 bp
  • T to A, chromosome 11 at 94,122,821 bp
  • G to A, chromosome 11 at 100,246,257 bp
  • T to C, chromosome 11 at 121,450,161 bp
  • A to T, chromosome 12 at 54,861,613 bp
  • T to C, chromosome 12 at 83,714,856 bp
  • T to C, chromosome 12 at 101,446,046 bp
  • A to G, chromosome 13 at 55,550,304 bp
  • A to C, chromosome 13 at 99,332,954 bp
  • C to T, chromosome 15 at 76,109,049 bp
  • C to A, chromosome 16 at 97,952,115 bp
  • G to A, chromosome 17 at 18,443,899 bp
  • T to C, chromosome 17 at 24,397,500 bp
  • C to T, chromosome 17 at 29,364,960 bp
  • A to C, chromosome 17 at 42,502,621 bp
  • T to C, chromosome 18 at 22,522,772 bp
  • T to A, chromosome 18 at 67,646,007 bp
  • A to G, chromosome 19 at 20,714,703 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8547 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068512-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.