Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8549Btlr/Mmmh
Stock Number:
068514-MU
Citation ID:
RRID:MMRRC_068514-MU
Other Names:
R8549 (G1)
Major Collection:

Strain Information

Ippk
Name: inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Synonyms: 1810043M15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75678
VEGA: 13
Homologene: 41495
Gad2
Name: glutamic acid decarboxylase 2
Synonyms: GAD65, Gad-2, 6330404F12Rik, GAD(65)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14417
HGNC: HGNC:4093
Homologene: 20223
Cyp39a1
Name: cytochrome P450, family 39, subfamily a, polypeptide 1
Synonyms: oxysterol 7-alpha-hydroxylase
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56050
VEGA: 17
Homologene: 9580
Rufy3
Name: RUN and FYVE domain containing 3
Synonyms: 2810428M05Rik, 6330416M07Rik, D5Bwg0860e, Rpipx
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52822
Homologene: 87809
Kif15
Name: kinesin family member 15
Synonyms: N-10 kinesin, HKLP2, 3930402I10Rik, 3110023M17Rik, Knsl7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209737
VEGA: 9
Homologene: 23210
Caprin1
Name: cell cycle associated protein 1
Synonyms: MMGPIP137, Gpiap1, caprin-1, RNG105
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 53872
HGNC: HGNC:6743
Homologene: 4310
Ank3
Name: ankyrin 3, epithelial
Synonyms: Ank-3, Ankyrin-3, AnkG, 2900054D09Rik, Ankyrin-G
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Topbp1
Name: topoisomerase (DNA) II binding protein 1
Synonyms: D430026L04Rik, 2810429C13Rik, 1110031N14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235559
Homologene: 38262
Snx29
Name: sorting nexin 29
Synonyms: LOC381035, LOC385605, 4933437K13Rik, Gm11170, Rundc2a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74478
Homologene: 32706
Mcm6
Name: minichromosome maintenance complex component 6
Synonyms: Mcmd6, D1Wsu22e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17219
HGNC: HGNC:6949
Homologene: 4322
Frmd8
Name: FERM domain containing 8
Synonyms: 4931429L16Rik, 2310035N23Rik, 1200004M23Rik, iTAP
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67457
Homologene: 32653
Eif5b
Name: eukaryotic translation initiation factor 5B
Synonyms: IF2, A030003E17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226982
Homologene: 134613
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Szt2
Name: SZT2 subunit of KICSTOR complex
Synonyms: seaizure threshold 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230676
Homologene: 49413
L1td1
Name: LINE-1 type transposase domain containing 1
Synonyms: ECAT11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381591
Homologene: 135709
Anpep
Name: alanyl aminopeptidase, membrane
Synonyms: Cd13, aminopeptidase N, Apn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16790
HGNC: HGNC:500
Homologene: 68163
Nip7
Name: NIP7, nucleolar pre-rRNA processing protein
Synonyms: 1110017C15Rik, 6330509M23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66164
Homologene: 56743
Rnase9
Name: ribonuclease, RNase A family, 9 (non-active)
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328401
VEGA: 14
Homologene: 18830
Arap3
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Synonyms: DRAG1, E030006K04Rik, Centd3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106952
VEGA: 18
Homologene: 11199
Eps8l1
Name: EPS8-like 1
Synonyms: 4632407K17Rik, EPS8R1, DRC3, 2310051G19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67425
Homologene: 15767
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 105242472
Nalcn
Name: sodium leak channel, non-selective
Synonyms: A530023G15Rik, Vgcnl1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Plcb1
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18795
Homologene: 22876
Aadacl4
Name: arylacetamide deacetylase like 4
Synonyms: Gm13177
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435815
Homologene: 82530
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
4930562C15Rik
Name: RIKEN cDNA 4930562C15 gene
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78809
Homologene: 53527
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Npc1l1
Name: NPC1 like intracellular cholesterol transporter 1
Synonyms: Niemann-Pick disease, type C1, 9130221N23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237636
HGNC: HGNC:7898
Homologene: 56585
Or4k48
Name: olfactory receptor family 4 subfamily K member 48
Synonyms: GA_x6K02T2Q125-72697413-72696475, MOR248-6, Olfr1298
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258888
Homologene: 121521
Ehhadh
Name: enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase
Synonyms: HD, MFP, L-bifunctional enzyme, L-PBE, 1300002P22Rik, MFP1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74147
HGNC: HGNC:3247
Homologene: 1486
Grip2
Name: glutamate receptor interacting protein 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243547
Homologene: 16327
Adcy7
Name: adenylate cyclase 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11513
HGNC: HGNC:238
Homologene: 866
Hrh4
Name: histamine receptor H4
Synonyms: H4R
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225192
VEGA: 18
Homologene: 11002
Cobll1
Name: Cobl-like 1
Synonyms: Coblr1, D430044D16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319876
Homologene: 8933
Yju2b
Name: YJU2 splicing factor homolog B
Synonyms: 4930527D15Rik, Ccdc130
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67736
Homologene: 12183
Zfp707
Name: zinc finger protein 707
Synonyms: 1500031N24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69020
Homologene: 18364
Zfp957
Name: zinc finger protein 957
Synonyms: AU017455
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105590
Defb33
Name: defensin beta 33
Synonyms: EG654453
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 654453
Zfp41
Name: zinc finger protein 41
Synonyms: CTfin92, Zfp-41
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22701
Homologene: 65280
Tagap
Name: T cell activation Rho GTPase activating protein
Synonyms: tcs-1, Tcd-1, tcs1, TRD, Tcd1, Tcd1a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72536
Homologene: 44943
Tcp10b
Name: t-complex protein 10b
Synonyms: T66B-a, D17Leh66ba, D17Leh66B, Tcp-10b, Tcp-10bt
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21462
Homologene: 83254
Gm5460
Name: predicted gene 5460
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 432838
VEGA: 14
Pcdhga1
Name: protocadherin gamma subfamily A, 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93709
HGNC: HGNC:8696
Homologene: 56824
Pcdha6
Name: protocadherin alpha 6
Synonyms: Cnr2, Crnr2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12937
Homologene: 75098
C1rb
Name: complement component 1, r subcomponent B
Synonyms: mC1rB, Gm8551
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 667277
HGNC: HGNC:1246
Homologene: 1313
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 38,037,207 bp
  • G to A, chromosome 1 at 60,235,562 bp
  • C to T, chromosome 1 at 128,345,948 bp
  • T to A, chromosome 2 at 22,635,047 bp
  • T to C, chromosome 2 at 65,098,450 bp
  • G to T, chromosome 2 at 103,769,517 bp
  • C to T, chromosome 2 at 111,649,167 bp
  • A to G, chromosome 2 at 135,364,933 bp
  • T to C, chromosome 4 at 98,738,043 bp
  • C to A, chromosome 4 at 118,372,681 bp
  • G to A, chromosome 4 at 144,623,156 bp
  • T to A, chromosome 5 at 88,647,214 bp
  • C to A, chromosome 6 at 91,773,788 bp
  • T to C, chromosome 6 at 124,574,539 bp
  • G to T, chromosome 7 at 4,470,854 bp
  • A to G, chromosome 7 at 79,840,896 bp
  • ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC to ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC, chromosome 7 at 142,165,420 bp
  • G to A, chromosome 8 at 20,897,578 bp
  • A to T, chromosome 8 at 84,258,770 bp
  • A to T, chromosome 8 at 88,326,190 bp
  • C to A, chromosome 8 at 107,057,973 bp
  • T to C, chromosome 9 at 103,324,378 bp
  • G to A, chromosome 9 at 108,111,452 bp
  • T to G, chromosome 9 at 110,514,419 bp
  • T to A, chromosome 9 at 122,986,171 bp
  • A to G, chromosome 10 at 69,982,182 bp
  • A to G, chromosome 11 at 6,218,675 bp
  • A to T, chromosome 11 at 104,999,695 bp
  • T to C, chromosome 13 at 49,461,701 bp
  • T to C, chromosome 14 at 34,036,935 bp
  • T to A, chromosome 14 at 51,038,991 bp
  • T to C, chromosome 14 at 79,213,906 bp
  • T to C, chromosome 14 at 123,370,036 bp
  • C to T, chromosome 15 at 75,618,691 bp
  • T to A, chromosome 15 at 75,974,698 bp
  • T to C, chromosome 16 at 4,863,197 bp
  • T to C, chromosome 16 at 11,715,056 bp
  • A to G, chromosome 16 at 20,741,277 bp
  • A to T, chromosome 16 at 21,766,418 bp
  • A to G, chromosome 17 at 7,933,965 bp
  • T to A, chromosome 17 at 13,063,028 bp
  • T to A, chromosome 17 at 43,730,995 bp
  • T to C, chromosome 18 at 13,022,058 bp
  • T to G, chromosome 18 at 36,968,541 bp
  • T to A, chromosome 18 at 37,833,333 bp
  • G to A, chromosome 18 at 37,973,312 bp
  • A to G, chromosome 19 at 5,869,537 bp
  • T to C, chromosome 19 at 7,457,259 bp
  • G to A, chromosome 19 at 9,011,483 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8549 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068514-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.