Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8557Btlr/Mmmh
Stock Number:
068520-MU
Citation ID:
RRID:MMRRC_068520-MU
Other Names:
R8557 (G1)
Major Collection:

Strain Information

Nefh
Name: neurofilament, heavy polypeptide
Synonyms: NF-H, NF200, NEFH
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380684
HGNC: HGNC:7737
Homologene: 40755
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Eri3
Name: exoribonuclease 3
Synonyms: PINT1, Prnpip1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140546
Homologene: 15403
Sec23a
Name: SEC23 homolog A, COPII coat complex component
Synonyms: Sec23r, Msec23
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20334
Homologene: 4642
Map4
Name: microtubule-associated protein 4
Synonyms: MAP 4, Mtap4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17758
HGNC: HGNC:6862
Homologene: 1780
Hdlbp
Name: high density lipoprotein (HDL) binding protein
Synonyms: D1Ertd101e, 1110005P14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 110611
HGNC: HGNC:4857
Homologene: 38035
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 93,413,497 bp
  • C to T, chromosome 1 at 139,456,756 bp
  • C to T, chromosome 1 at 162,544,352 bp
  • A to T, chromosome 2 at 167,484,307 bp
  • T to C, chromosome 2 at 177,509,561 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • T to A, chromosome 3 at 24,208,364 bp
  • C to A, chromosome 3 at 129,754,951 bp
  • T to A, chromosome 4 at 103,139,346 bp
  • T to A, chromosome 4 at 108,367,888 bp
  • T to A, chromosome 4 at 108,542,711 bp
  • C to T, chromosome 4 at 115,570,241 bp
  • T to C, chromosome 4 at 117,615,323 bp
  • T to C, chromosome 4 at 129,948,968 bp
  • C to T, chromosome 4 at 141,470,370 bp
  • A to T, chromosome 5 at 35,828,139 bp
  • T to C, chromosome 5 at 63,898,611 bp
  • T to C, chromosome 5 at 76,229,370 bp
  • A to G, chromosome 5 at 121,310,651 bp
  • A to T, chromosome 5 at 145,244,025 bp
  • A to T, chromosome 6 at 13,193,137 bp
  • T to C, chromosome 6 at 36,524,075 bp
  • A to T, chromosome 6 at 65,120,015 bp
  • T to A, chromosome 6 at 122,063,701 bp
  • A to G, chromosome 7 at 19,348,555 bp
  • C to T, chromosome 7 at 44,255,848 bp
  • C to T, chromosome 7 at 98,053,874 bp
  • A to T, chromosome 7 at 101,290,656 bp
  • T to A, chromosome 7 at 104,635,896 bp
  • A to G, chromosome 9 at 110,064,302 bp
  • G to T, chromosome 9 at 119,432,588 bp
  • A to G, chromosome 9 at 120,417,186 bp
  • G to T, chromosome 10 at 80,691,174 bp
  • T to C, chromosome 10 at 127,278,193 bp
  • A to G, chromosome 11 at 3,346,379 bp
  • A to T, chromosome 11 at 4,941,233 bp
  • T to A, chromosome 11 at 58,455,736 bp
  • C to A, chromosome 11 at 75,156,238 bp
  • C to T, chromosome 11 at 108,409,236 bp
  • C to A, chromosome 11 at 113,250,559 bp
  • A to G, chromosome 11 at 120,815,784 bp
  • G to T, chromosome 12 at 59,005,270 bp
  • T to A, chromosome 12 at 59,101,488 bp
  • T to A, chromosome 12 at 84,649,916 bp
  • A to G, chromosome 12 at 117,878,512 bp
  • A to T, chromosome 13 at 74,704,182 bp
  • A to G, chromosome 13 at 118,781,596 bp
  • G to A, chromosome 14 at 31,210,605 bp
  • G to A, chromosome 14 at 61,207,276 bp
  • G to A, chromosome 14 at 70,977,297 bp
  • A to T, chromosome 14 at 79,009,209 bp
  • A to G, chromosome 15 at 102,454,412 bp
  • A to G, chromosome 15 at 103,248,598 bp
  • A to T, chromosome 16 at 23,146,680 bp
  • A to T, chromosome 17 at 22,571,929 bp
  • G to A, chromosome 17 at 23,667,562 bp
  • A to T, chromosome 17 at 24,510,041 bp
  • T to C, chromosome 17 at 57,224,383 bp
  • A to G, chromosome 17 at 74,405,690 bp
  • A to G, chromosome 17 at 83,221,066 bp
  • A to T, chromosome 18 at 65,203,915 bp
  • T to A, chromosome 19 at 55,192,673 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8557 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068520-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.