Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8557Btlr/Mmmh
Stock Number:
068520-MU
Citation ID:
RRID:MMRRC_068520-MU
Other Names:
R8557 (G1)
Major Collection:

Strain Information

Nefh
Name: neurofilament, heavy polypeptide
Synonyms: NF-H, NF200, NEFH
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380684
HGNC: HGNC:7737
Homologene: 40755
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Eri3
Name: exoribonuclease 3
Synonyms: PINT1, Prnpip1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140546
Homologene: 15403
Sec23a
Name: SEC23 homolog A, COPII coat complex component
Synonyms: Sec23r, Msec23
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20334
Homologene: 4642
Map4
Name: microtubule-associated protein 4
Synonyms: MAP 4, Mtap4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17758
HGNC: HGNC:6862
Homologene: 1780
Hdlbp
Name: high density lipoprotein (HDL) binding protein
Synonyms: D1Ertd101e, 1110005P14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 110611
HGNC: HGNC:4857
Homologene: 38035
Tut4
Name: terminal uridylyl transferase 4
Synonyms: 6030404K05Rik, 9230115F04Rik, Tent3a, Zcchc11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230594
Homologene: 35279
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Nedd4l
Name: neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms: Nedd4-2, 1300012C07Rik, Nedd4b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 83814
VEGA: 18
HGNC: HGNC:7728
Homologene: 86986
Mier1
Name: MEIR1 treanscription regulator
Synonyms: 5830411K19Rik, 4933425I22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71148
Homologene: 136176
Slc30a6
Name: solute carrier family 30 (zinc transporter), member 6
Synonyms: ZnT6, ZnT-6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210148
VEGA: 17
Homologene: 32380
Smg6
Name: SMG6 nonsense mediated mRNA decay factor
Synonyms: Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103677
Homologene: 23024
Fasn
Name: fatty acid synthase
Synonyms: FAS, A630082H08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14104
HGNC: HGNC:3594
Homologene: 55800
Amhr2
Name: anti-Mullerian hormone type 2 receptor
Synonyms: MIS TypeII receptor, MISIIR
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110542
HGNC: HGNC:465
Homologene: 10746
Clock
Name: clock circadian regulator
Synonyms: 5330400M04Rik, KAT13D, bHLHe8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12753
HGNC: HGNC:2082
Homologene: 3603
Mettl13
Name: methyltransferase 13, eEF1A lysine and N-terminal methyltransferase
Synonyms: 5630401D24Rik, Eef1aknmt
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71449
Homologene: 32285
Slc39a11
Name: solute carrier family 39 (metal ion transporter), member 11
Synonyms: 1810074D23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69806
Homologene: 12331
Traf7
Name: TNF receptor-associated factor 7
Synonyms: RFWD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224619
Homologene: 12998
C3
Name: complement component 3
Synonyms: complement factor 3, acylation stimulating protein, Plp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12266
HGNC: HGNC:1318
Homologene: 68031
Shisal2a
Name: shisa like 2A
Synonyms: OTTMUSG00000008243, Fam159a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545667
Homologene: 82675
Ercc1
Name: excision repair cross-complementing rodent repair deficiency, complementation group 1
Synonyms: Ercc-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13870
HGNC: HGNC:3433
Homologene: 1501
Dctn2
Name: dynactin 2
Synonyms: RBP50, DCTN-50, p50, 2310042E05Rik, C130077D06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69654
VEGA: 10
HGNC: HGNC:2712
Homologene: 4667
Limk2
Name: LIM domain kinase 2
Synonyms: Limk2b, Limk2a, A930024P04Rik, LIM kinase 2, whe
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16886
HGNC: HGNC:6614
Homologene: 55911
Zfp655
Name: zinc finger protein 655
Synonyms: 9030409O18Rik, 2700038I16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72611
Homologene: 12473
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Gfra2
Name: glial cell line derived neurotrophic factor family receptor alpha 2
Synonyms: GFR alpha 2, GFR alpha-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14586
VEGA: 14
HGNC: HGNC:4244
Homologene: 1145
Myo7a
Name: myosin VIIA
Synonyms: Myo7, USH1B, nmf371, polka, Hdb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Fgf10
Name: fibroblast growth factor 10
Synonyms: FGF-10, AEY17, Gsfaey17
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14165
HGNC: HGNC:3666
Homologene: 3284
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b598Clo, b2b1289Clo, b2b1727Clo, b2b1203Clo, b2b1279Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Spocd1
Name: SPOC domain containing 1
Synonyms: OTTMUSG00000009522
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 622480
Homologene: 83439
Vrtn
Name: vertebrae development associated
Synonyms: 7420416P09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 432677
VEGA: 12
Homologene: 41236
Vmn2r111
Name: vomeronasal 2, receptor 111
Synonyms: EG210876
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210876
Homologene: 86604
Vwa8
Name: von Willebrand factor A domain containing 8
Synonyms: 4932416F07Rik, 1300010F03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219189
VEGA: 14
Homologene: 44881
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Vwde
Name: von Willebrand factor D and EGF domains
Synonyms: LOC232585
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232585
Homologene: 35456
Chrm2
Name: cholinergic receptor, muscarinic 2, cardiac
Synonyms: M2, AChR M2, muscarinic acetylcholine receptor 2, Chrm-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243764
HGNC: HGNC:1951
Homologene: 20190
Tnnc1
Name: troponin C, cardiac/slow skeletal
Synonyms: cTnC, TnC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21924
Homologene: 55728
Mug2
Name: murinoglobulin 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17837
HGNC: HGNC:9750
Homologene: 136663
Apoh
Name: apolipoprotein H
Synonyms: beta-2-glycoprotein 1, beta-2-GPI, B2GPI
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11818
HGNC: HGNC:616
Homologene: 26
Tectb
Name: tectorin beta
Synonyms: [b]-tectorin, Tctnb
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21684
Homologene: 7568
Adipoq
Name: adiponectin, C1Q and collagen domain containing
Synonyms: adiponectin, adipo, apM1, GBP28, Acrp30, Acdc, APN, Ad
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11450
Homologene: 3525
0610040J01Rik
Name: RIKEN cDNA 0610040J01 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76261
Homologene: 49537
Atg16l2
Name: autophagy related 16 like 2
Synonyms: 2410118P20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73683
Homologene: 18981
Mob3a
Name: MOB kinase activator 3A
Synonyms: 5330417K06Rik, Mobkl2a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 208228
VEGA: 10
Homologene: 41587
Pkdcc
Name: protein kinase domain containing, cytoplasmic
Synonyms: ESTM17, Vlk, MAd1, Adtk1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106522
Homologene: 18932
Cyp4a31
Name: cytochrome P450, family 4, subfamily a, polypeptide 31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 666168
HGNC: HGNC:2642
Homologene: 128044
Spata2
Name: spermatogenesis associated 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 263876
Homologene: 4407
Acvr2b
Name: activin receptor IIB
Synonyms: ActRIIB
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11481
VEGA: 9
HGNC: HGNC:174
Homologene: 863
Myrip
Name: myosin VIIA and Rab interacting protein
Synonyms: Slac2-c, A230081N12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 245049
Homologene: 9150
Or2z2
Name: olfactory receptor family 2 subfamily Z member 2
Synonyms: MTPCR07, GA_x6K02T2NKPP-957001-957948, MOR281-1, Olfr30
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18329
Homologene: 131139
Nfe2
Name: nuclear factor, erythroid derived 2
Synonyms: NF-E2, p45, p45nf-e2, p45NFE2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18022
HGNC: HGNC:7780
Homologene: 4491
Acp4
Name: acid phosphatase 4
Synonyms: EG546967, Acpt
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100503991
Homologene: 57200
Bicdl2
Name: BICD family like cargo adaptor 2
Synonyms: Ccdc64b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 212733
VEGA: 17
Homologene: 17815
Or56b1
Name: olfactory receptor family 56 subfamily B member 1
Synonyms: GA_x6K02T2PBJ9-7263864-7264823, MOR40-13, Olfr657
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258309
Homologene: 17189
Hpgds
Name: hematopoietic prostaglandin D synthase
Synonyms: H-PGDS, Ptgds2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54486
Homologene: 113741
Naaladl2
Name: N-acetylated alpha-linked acidic dipeptidase-like 2
Synonyms: LOC381500, 2810043G22Rik, EG635702
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 635702
Homologene: 45786
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 93,413,497 bp
  • C to T, chromosome 1 at 139,456,756 bp
  • C to T, chromosome 1 at 162,544,352 bp
  • A to T, chromosome 2 at 167,484,307 bp
  • T to C, chromosome 2 at 177,509,561 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • T to A, chromosome 3 at 24,208,364 bp
  • C to A, chromosome 3 at 129,754,951 bp
  • T to A, chromosome 4 at 103,139,346 bp
  • T to A, chromosome 4 at 108,367,888 bp
  • T to A, chromosome 4 at 108,542,711 bp
  • C to T, chromosome 4 at 115,570,241 bp
  • T to C, chromosome 4 at 117,615,323 bp
  • T to C, chromosome 4 at 129,948,968 bp
  • C to T, chromosome 4 at 141,470,370 bp
  • A to T, chromosome 5 at 35,828,139 bp
  • T to C, chromosome 5 at 63,898,611 bp
  • T to C, chromosome 5 at 76,229,370 bp
  • A to G, chromosome 5 at 121,310,651 bp
  • A to T, chromosome 5 at 145,244,025 bp
  • A to T, chromosome 6 at 13,193,137 bp
  • T to C, chromosome 6 at 36,524,075 bp
  • A to T, chromosome 6 at 65,120,015 bp
  • T to A, chromosome 6 at 122,063,701 bp
  • A to G, chromosome 7 at 19,348,555 bp
  • C to T, chromosome 7 at 44,255,848 bp
  • C to T, chromosome 7 at 98,053,874 bp
  • A to T, chromosome 7 at 101,290,656 bp
  • T to A, chromosome 7 at 104,635,896 bp
  • A to G, chromosome 9 at 110,064,302 bp
  • G to T, chromosome 9 at 119,432,588 bp
  • A to G, chromosome 9 at 120,417,186 bp
  • G to T, chromosome 10 at 80,691,174 bp
  • T to C, chromosome 10 at 127,278,193 bp
  • A to G, chromosome 11 at 3,346,379 bp
  • A to T, chromosome 11 at 4,941,233 bp
  • T to A, chromosome 11 at 58,455,736 bp
  • C to A, chromosome 11 at 75,156,238 bp
  • C to T, chromosome 11 at 108,409,236 bp
  • C to A, chromosome 11 at 113,250,559 bp
  • A to G, chromosome 11 at 120,815,784 bp
  • G to T, chromosome 12 at 59,005,270 bp
  • T to A, chromosome 12 at 59,101,488 bp
  • T to A, chromosome 12 at 84,649,916 bp
  • A to G, chromosome 12 at 117,878,512 bp
  • A to T, chromosome 13 at 74,704,182 bp
  • A to G, chromosome 13 at 118,781,596 bp
  • G to A, chromosome 14 at 31,210,605 bp
  • G to A, chromosome 14 at 61,207,276 bp
  • G to A, chromosome 14 at 70,977,297 bp
  • A to T, chromosome 14 at 79,009,209 bp
  • A to G, chromosome 15 at 102,454,412 bp
  • A to G, chromosome 15 at 103,248,598 bp
  • A to T, chromosome 16 at 23,146,680 bp
  • A to T, chromosome 17 at 22,571,929 bp
  • G to A, chromosome 17 at 23,667,562 bp
  • A to T, chromosome 17 at 24,510,041 bp
  • T to C, chromosome 17 at 57,224,383 bp
  • A to G, chromosome 17 at 74,405,690 bp
  • A to G, chromosome 17 at 83,221,066 bp
  • A to T, chromosome 18 at 65,203,915 bp
  • T to A, chromosome 19 at 55,192,673 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8557 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068520-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.