Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8675Btlr/Mmmh
Stock Number:
068530-MU
Citation ID:
RRID:MMRRC_068530-MU
Other Names:
R8675 (G1)
Major Collection:

Strain Information

Cacng7
Name: calcium channel, voltage-dependent, gamma subunit 7
Synonyms: TARP gamma 7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81904
Homologene: 12895
Abl2
Name: ABL proto-oncogene 2, non-receptor tyrosine kinase
Synonyms: Arg, Abll
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11352
HGNC: HGNC:77
Homologene: 5278
Snrnp200
Name: small nuclear ribonucleoprotein 200 (U5)
Synonyms: U5-200KD, HELIC2, A330064G03Rik, Ascc3l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320632
Homologene: 5859
Stx16
Name: syntaxin 16
Synonyms: 5430410K23Rik, SYN16, 6330500A18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228960
Homologene: 2791
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, Tulip1, 2310003F20Rik, Garnl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56784
VEGA: 12
Homologene: 84805
Gigyf2
Name: GRB10 interacting GYF protein 2
Synonyms: A830080H02Rik, 2610016F01Rik, Tnrc15
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227331
Homologene: 41048
Ubr3
Name: ubiquitin protein ligase E3 component n-recognin 3
Synonyms: 4833421P10Rik, A130030D10Rik, 1110059H15Rik, Zfp650
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68795
Homologene: 52092
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 87,403,716 bp
  • A to T, chromosome 1 at 130,907,435 bp
  • T to C, chromosome 1 at 132,059,188 bp
  • T to C, chromosome 1 at 156,625,339 bp
  • A to G, chromosome 1 at 174,230,683 bp
  • T to A, chromosome 2 at 70,020,521 bp
  • A to G, chromosome 2 at 127,232,523 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • T to C, chromosome 2 at 174,092,462 bp
  • T to C, chromosome 4 at 45,813,469 bp
  • C to T, chromosome 4 at 63,583,871 bp
  • C to T, chromosome 5 at 11,774,006 bp
  • T to A, chromosome 6 at 120,481,988 bp
  • G to A, chromosome 7 at 3,336,705 bp
  • A to G, chromosome 7 at 6,378,281 bp
  • G to A, chromosome 7 at 29,143,027 bp
  • A to G, chromosome 7 at 45,154,382 bp
  • A to G, chromosome 7 at 45,723,869 bp
  • A to G, chromosome 7 at 121,899,251 bp
  • A to G, chromosome 7 at 135,514,151 bp
  • G to A, chromosome 8 at 71,645,715 bp
  • C to T, chromosome 9 at 44,111,890 bp
  • T to C, chromosome 9 at 121,664,666 bp
  • A to G, chromosome 10 at 34,608,497 bp
  • T to C, chromosome 10 at 80,323,062 bp
  • A to G, chromosome 11 at 8,848,916 bp
  • A to G, chromosome 11 at 70,554,887 bp
  • A to G, chromosome 11 at 71,025,674 bp
  • T to A, chromosome 11 at 101,590,396 bp
  • T to C, chromosome 11 at 119,456,158 bp
  • T to C, chromosome 12 at 55,738,217 bp
  • T to G, chromosome 12 at 81,660,605 bp
  • T to A, chromosome 12 at 117,584,162 bp
  • A to G, chromosome 13 at 21,423,013 bp
  • A to T, chromosome 13 at 23,232,437 bp
  • T to C, chromosome 16 at 32,804,970 bp
  • T to A, chromosome 17 at 28,069,591 bp
  • G to T, chromosome 17 at 48,090,329 bp
  • T to A, chromosome 18 at 20,601,918 bp
  • A to G, chromosome 18 at 38,199,176 bp
  • T to C, chromosome 18 at 67,491,308 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8675 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068530-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.