Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8675Btlr/Mmmh
Stock Number:
068530-MU
Citation ID:
RRID:MMRRC_068530-MU
Other Names:
R8675 (G1)
Major Collection:

Strain Information

Cacng7
Name: calcium channel, voltage-dependent, gamma subunit 7
Synonyms: TARP gamma 7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81904
Homologene: 12895
Abl2
Name: ABL proto-oncogene 2, non-receptor tyrosine kinase
Synonyms: Abll, Arg
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11352
HGNC: HGNC:77
Homologene: 5278
Snrnp200
Name: small nuclear ribonucleoprotein 200 (U5)
Synonyms: U5-200KD, HELIC2, A330064G03Rik, Ascc3l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320632
Homologene: 5859
Stx16
Name: syntaxin 16
Synonyms: 5430410K23Rik, SYN16, 6330500A18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228960
Homologene: 2791
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, Tulip1, 2310003F20Rik, Garnl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56784
VEGA: 12
Homologene: 84805
Gigyf2
Name: GRB10 interacting GYF protein 2
Synonyms: A830080H02Rik, 2610016F01Rik, Tnrc15
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227331
Homologene: 41048
Ubr3
Name: ubiquitin protein ligase E3 component n-recognin 3
Synonyms: 4833421P10Rik, A130030D10Rik, 1110059H15Rik, Zfp650
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68795
Homologene: 52092
Il20
Name: interleukin 20
Synonyms: Zcyto10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 58181
HGNC: HGNC:6002
Homologene: 10286
Dsg2
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13511
HGNC: HGNC:3049
Homologene: 1464
Pigt
Name: phosphatidylinositol glycan anchor biosynthesis, class T
Synonyms: CGI-06, 4930534E15Rik, Ndap7, NDAP, 2510012P17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78928
Homologene: 6134
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Mis12
Name: MIS12 kinetochore complex component
Synonyms: 2510025F08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67139
Homologene: 11429
Spta1
Name: spectrin alpha, erythrocytic 1
Synonyms: Spna-1, erythroid, ihj, Spna1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20739
Homologene: 74460
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 672511
Homologene: 45439
Rapgef5
Name: Rap guanine nucleotide exchange factor (GEF) 5
Synonyms: mr-gef, D030051B22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217944
VEGA: 12
Homologene: 56563
Vipr1
Name: vasoactive intestinal peptide receptor 1
Synonyms: VIP-R1, VPAC1, VIP receptor subtype 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22354
Homologene: 3399
Il17ra
Name: interleukin 17 receptor A
Synonyms: VDw217, Il17r
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16172
HGNC: HGNC:5985
Homologene: 7378
Unc13a
Name: unc-13 homolog A
Synonyms: Munc13-1, 2410078G03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382018
Homologene: 11279
Rasgrp4
Name: RAS guanyl releasing protein 4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233046
Homologene: 15635
Tmem106a
Name: transmembrane protein 106A
Synonyms: 0610008L10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217203
Homologene: 16996
Vmn1r222
Name: vomeronasal 1 receptor 222
Synonyms: V1rh16
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171274
Homologene: 110880
Tmem268
Name: transmembrane protein 268
Synonyms: 6330416G13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230279
Homologene: 17005
Pgbd1
Name: piggyBac transposable element derived 1
Synonyms: 4921509E05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319207
Homologene: 130030
Scnn1b
Name: sodium channel, nonvoltage-gated 1 beta
Synonyms: ENaC beta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20277
Homologene: 133555
Fam83e
Name: family with sequence similarity 83, member E
Synonyms: 4930403C10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73813
Homologene: 9791
Frk
Name: fyn-related kinase
Synonyms: BSK/IYK, GTK
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14302
VEGA: 10
HGNC: HGNC:3955
Homologene: 48065
Mfsd4a
Name: major facilitator superfamily domain containing 4A
Synonyms: A930031D07Rik, Mfsd4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213006
Homologene: 45419
1700067P10Rik
Name: RIKEN cDNA 1700067P10 gene
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68224
VEGA: 17
Homologene: 87035
Spire1
Name: spire type actin nucleation factor 1
Synonyms: Spir-1, 6030430B19Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 68166
VEGA: 18
Homologene: 35507
Tcp11
Name: t-complex protein 11
Synonyms: D17Ken1, Tcp-11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21463
Homologene: 8433
Ttc9
Name: tetratricopeptide repeat domain 9
Synonyms: 1700029M07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69480
VEGA: 12
Homologene: 52649
Zfp78
Name: zinc finger protein 78
Synonyms: KRAB12, Zfp77
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330463
Homologene: 128524
Pcsk4
Name: proprotein convertase subtilisin/kexin type 4
Synonyms: PC4, SPC5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18551
HGNC: HGNC:8746
Homologene: 22495
Pcdh1
Name: protocadherin 1
Synonyms: 2010005A06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75599
HGNC: HGNC:8655
Homologene: 12613
Clrn3
Name: clarin 3
Synonyms: Tmem12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212070
Homologene: 17544
Pih1d1
Name: PIH1 domain containing 1
Synonyms: 4933413A04Rik, 1110061L23Rik, Nop17
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68845
Homologene: 9914
Igfbpl1
Name: insulin-like growth factor binding protein-like 1
Synonyms: 2810011G06Rik, IGFBP-like protein, 2810453O06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75426
Homologene: 10292
Gm49380
Name: predicted gene, 49380
Type: Gene
Species: Mouse
Chromosome: 9
Smbd1
Name: somatomedin B domain containing 1
Synonyms: LOC381043, LOC385630, Gm933
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 381043
Homologene: 136544
Speer1b
Name: spermatogenesis associated glutamate (E)-rich protein 1B
Synonyms: Gm8926
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 668017
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 87,403,716 bp
  • A to T, chromosome 1 at 130,907,435 bp
  • T to C, chromosome 1 at 132,059,188 bp
  • T to C, chromosome 1 at 156,625,339 bp
  • A to G, chromosome 1 at 174,230,683 bp
  • T to A, chromosome 2 at 70,020,521 bp
  • A to G, chromosome 2 at 127,232,523 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • T to C, chromosome 2 at 174,092,462 bp
  • T to C, chromosome 4 at 45,813,469 bp
  • C to T, chromosome 4 at 63,583,871 bp
  • C to T, chromosome 5 at 11,774,006 bp
  • T to A, chromosome 6 at 120,481,988 bp
  • G to A, chromosome 7 at 3,336,705 bp
  • A to G, chromosome 7 at 6,378,281 bp
  • G to A, chromosome 7 at 29,143,027 bp
  • A to G, chromosome 7 at 45,154,382 bp
  • A to G, chromosome 7 at 45,723,869 bp
  • A to G, chromosome 7 at 121,899,251 bp
  • A to G, chromosome 7 at 135,514,151 bp
  • G to A, chromosome 8 at 71,645,715 bp
  • C to T, chromosome 9 at 44,111,890 bp
  • T to C, chromosome 9 at 121,664,666 bp
  • A to G, chromosome 10 at 34,608,497 bp
  • T to C, chromosome 10 at 80,323,062 bp
  • A to G, chromosome 11 at 8,848,916 bp
  • A to G, chromosome 11 at 70,554,887 bp
  • A to G, chromosome 11 at 71,025,674 bp
  • T to A, chromosome 11 at 101,590,396 bp
  • T to C, chromosome 11 at 119,456,158 bp
  • T to C, chromosome 12 at 55,738,217 bp
  • T to G, chromosome 12 at 81,660,605 bp
  • T to A, chromosome 12 at 117,584,162 bp
  • A to G, chromosome 13 at 21,423,013 bp
  • A to T, chromosome 13 at 23,232,437 bp
  • T to C, chromosome 16 at 32,804,970 bp
  • T to A, chromosome 17 at 28,069,591 bp
  • G to T, chromosome 17 at 48,090,329 bp
  • T to A, chromosome 18 at 20,601,918 bp
  • A to G, chromosome 18 at 38,199,176 bp
  • T to C, chromosome 18 at 67,491,308 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8675 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068530-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.