Strain Name:
C57BL/6J-MtgxR8676Btlr/Mmmh
Stock Number:
068531-MU
Citation ID:
RRID:MMRRC_068531-MU
Other Names:
R8676 (G1)
Major Collection:

Strain Information

Zdhhc17
Name: zinc finger, DHHC domain containing 17
Synonyms: D130071N24Rik, A230053P19Rik, Hip14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320150
VEGA: 10
Homologene: 56324
Zfp423
Name: zinc finger protein 423
Synonyms: Roaz, ataxia1, Zfp104, Ebfaz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Epb41l2
Name: erythrocyte membrane protein band 4.1 like 2
Synonyms: NBL2, 4.1G, D10Ertd398e, Epb4.1l2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13822
VEGA: 10
HGNC: HGNC:3379
Homologene: 37478
Adipor2
Name: adiponectin receptor 2
Synonyms: 1110001I14Rik, D6Ucla1e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68465
Homologene: 56119
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Cot, Tpl2, c-COT, Tpl-2, Cot/Tpl2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Bnc2
Name: basonuclin zinc finger protein 2
Synonyms: 5031434M05Rik, 8430420F16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242509
Homologene: 18243
Rcbtb1
Name: regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Synonyms: 5430409I18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71330
Homologene: 10061
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Heatr5a
Name: HEAT repeat containing 5A
Synonyms: D930036F22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320487
VEGA: 12
Homologene: 19635
Polr3b
Name: polymerase (RNA) III (DNA directed) polypeptide B
Synonyms: RPC2, 2700078H01Rik, A330032P03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70428
VEGA: 10
Homologene: 6981
Eftud2
Name: elongation factor Tu GTP binding domain containing 2
Synonyms: U5-116kD, 116kDa, Snrp116
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20624
Homologene: 3133
Rspry1
Name: ring finger and SPRY domain containing 1
Synonyms: 4930470D19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67610
Homologene: 12164
Ankrd27
Name: ankyrin repeat domain 27
Synonyms: D330003H11Rik, Varp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 245886
Homologene: 12956
Zfp74
Name: zinc finger protein 74
Synonyms: Zfp66, KRAB8, 2810054M15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72723
Homologene: 51861
Anxa6
Name: annexin A6
Synonyms: Camb, Anx6, AnxVI, Annexin VI, Cabm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11749
HGNC: HGNC:544
Homologene: 55558
Dera
Name: deoxyribose-phosphate aldolase
Synonyms: 2010002D22Rik, 2500002K03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232449
Homologene: 14562
Mpp7
Name: membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)
Synonyms: 5430426E14Rik, 2810038M04Rik, LOC381166, 1110068J02Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75739
VEGA: 18
Homologene: 1455
Ccdc88a
Name: coiled coil domain containing 88A
Synonyms: C330012F17Rik, D130005J21Rik, C130096N06Rik, GIV, HkRP1, Girdin, A430106J12Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108686
Homologene: 41180
Cyp20a1
Name: cytochrome P450, family 20, subfamily a, polypeptide 1
Synonyms: A930011N14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77951
Homologene: 18584
Zfp975
Name: zinc finger protein 975
Synonyms: Gm5595
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434179
Homologene: 134004
Scn2b
Name: sodium channel, voltage-gated, type II, beta
Synonyms: LOC214238, 2810451E09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72821
VEGA: 9
Homologene: 3373
Stk32b
Name: serine/threonine kinase 32B
Synonyms: 2510009F08Rik, YANK2, STKG6, Stk32
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 64293
Homologene: 48654
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: Ip3r3, Itpr-3, tf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Prkg1
Name: protein kinase, cGMP-dependent, type I
Synonyms: Prkgr1b, Prkg1b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19091
HGNC: HGNC:9414
Homologene: 55964
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, nmf112, nmf181, nmf252, bob, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Tek
Name: TEK receptor tyrosine kinase
Synonyms: Hyk, Tie2, Cd202b, tie-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21687
Homologene: 397
Hyal4
Name: hyaluronoglucosaminidase 4
Synonyms: 4632428M18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 77042
HGNC: HGNC:5323
Homologene: 69117
Myh13
Name: myosin, heavy polypeptide 13, skeletal muscle
Synonyms: extraocular myosin, EO Myosin, MyHC-eo
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544791
HGNC: HGNC:7571
Homologene: 55780
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b598Clo, b2b1289Clo, b2b1727Clo, b2b1203Clo, b2b1279Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Btnl6
Name: butyrophilin-like 6
Synonyms: NG13, Gm6519
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 624681
Homologene: 106849
Pcdhb5
Name: protocadherin beta 5
Synonyms: Pcdhb4A, PcdhbE
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93876
HGNC: HGNC:8689
Homologene: 75103
Tmem89
Name: transmembrane protein 89
Synonyms: 1700024B07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69384
Homologene: 52857
Ugt2b38
Name: UDP glucuronosyltransferase 2 family, polypeptide B38
Synonyms: 9430041C03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100559
Homologene: 137225
Cyld
Name: CYLD lysine 63 deubiquitinase
Synonyms: CYLD1, 2010013M14Rik, C130039D01Rik, 2900009M21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74256
HGNC: HGNC:2584
Homologene: 9069
Taar4
Name: trace amine-associated receptor 4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209513
Homologene: 45509
Gli3
Name: GLI-Kruppel family member GLI3
Synonyms: Bph, brachyphalangy
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14634
HGNC: HGNC:4319
Homologene: 139
Hnf4g
Name: hepatocyte nuclear factor 4, gamma
Synonyms: NR2A2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 30942
HGNC: HGNC:5026
Homologene: 37886
Spata20
Name: spermatogenesis associated 20
Synonyms: Tisp78
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217116
Homologene: 11264
Psg19
Name: pregnancy specific beta-1-glycoprotein 19
Synonyms: CGM7, Cea-4, Cea4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26439
HGNC: HGNC:1819
Homologene: 110989
Alk
Name: anaplastic lymphoma kinase
Synonyms: Tcrz, CD246
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11682
VEGA: 17
HGNC: HGNC:427
Homologene: 68387
Fam186a
Name: family with sequence similarity 186, member A
Synonyms: LOC380973, 1700030F18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72277
Vmn2r11
Name: vomeronasal 2, receptor 11
Synonyms: EG384219
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384219
Homologene: 129606
Proz
Name: protein Z, vitamin K-dependent plasma glycoprotein
Synonyms: 1300015B06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66901
HGNC: HGNC:9460
Homologene: 2890
Prob1
Name: proline rich basic protein 1
Synonyms: LOC381148, Gm1614
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381148
Homologene: 83773
Cfap43
Name: cilia and flagella associated protein 43
Synonyms: 4930428C11Rik, 4632415N18Rik, 4930463G05Rik, D19Ertd652e, Wdr96
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100048534
Homologene: 36425
Vmn1r201
Name: vomeronasal 1 receptor 201
Synonyms: V1ri4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171255
Homologene: 110880
Entrep1
Name: endosomal transmembrane epsin interactor 1
Synonyms: LOC381217, Fam189a2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381217
VEGA: 19
Homologene: 3540
Tchh
Name: trichohyalin
Synonyms: AHF, Thh
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99681
Homologene: 136273
Aadacl4fm4
Name: AADACL4 family member 4
Synonyms: LOC230890, Gm436
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230890
Homologene: 135765
Kcna3
Name: potassium voltage-gated channel, shaker-related subfamily, member 3
Synonyms: Kv1.3, Kca1-3, Mk-3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16491
HGNC: HGNC:6221
Homologene: 128570
Rnf144b
Name: ring finger protein 144B
Synonyms: E130105P19Rik, Ibrdc2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218215
VEGA: 13
Homologene: 27092
Or5ap2
Name: olfactory receptor family 5 subfamily AP member 2
Synonyms: GA_x6K02T2Q125-47327964-47328917, MOR201-2, Olfr1020
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258573
Homologene: 45007
Acsm3
Name: acyl-CoA synthetase medium-chain family member 3
Synonyms: Sa, Sah
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20216
Homologene: 74559
Or13p5
Name: olfactory receptor family 13 subfamily P member 5
Synonyms: GA_x6K02T2QD9B-18815145-18814198, MOR258-2, Olfr1339
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258851
Homologene: 27280
Kcnc3
Name: potassium voltage gated channel, Shaw-related subfamily, member 3
Synonyms: Kv3.3, KShIIID, Kcr2-3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16504
HGNC: HGNC:6235
Homologene: 3650
Or8b52
Name: olfactory receptor family 8 subfamily B member 52
Synonyms: GA_x6K02T2PVTD-32368166-32367237, MOR168-2P, Olfr917
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258183
VEGA: 9
Vmn1r16
Name: vomeronasal 1 receptor 16
Synonyms: V1rc29
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171202
Homologene: 123821
Czib
Name: CXXC motif containing zinc binding protein
Synonyms: 0610037L13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74098
Homologene: 41206
Mtres1
Name: mitochondrial transcription rescue factor 1
Synonyms: 1700021F05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67851
Homologene: 41137
Gm6408
Name: predicted gene 6408
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 623198
Homologene: 86127
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 60,379,420 bp
  • T to A, chromosome 2 at 85,849,902 bp
  • A to T, chromosome 3 at 3,643,073 bp
  • CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC to CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC, chromosome 3 at 93,446,708 bp
  • A to G, chromosome 3 at 107,036,592 bp
  • T to C, chromosome 4 at 84,276,313 bp
  • A to T, chromosome 4 at 94,849,837 bp
  • A to G, chromosome 4 at 107,895,599 bp
  • C to A, chromosome 4 at 118,735,038 bp
  • G to A, chromosome 4 at 144,670,113 bp
  • T to A, chromosome 5 at 37,457,159 bp
  • T to C, chromosome 5 at 87,411,822 bp
  • A to C, chromosome 5 at 109,053,760 bp
  • A to G, chromosome 5 at 146,482,427 bp
  • C to A, chromosome 6 at 24,755,827 bp
  • C to T, chromosome 6 at 57,322,829 bp
  • G to T, chromosome 6 at 119,363,486 bp
  • A to T, chromosome 6 at 137,830,204 bp
  • A to G, chromosome 7 at 18,794,065 bp
  • T to C, chromosome 7 at 29,934,654 bp
  • T to C, chromosome 7 at 35,602,584 bp
  • A to T, chromosome 7 at 42,662,840 bp
  • C to A, chromosome 7 at 44,591,596 bp
  • C to A, chromosome 7 at 56,188,613 bp
  • T to A, chromosome 7 at 119,775,169 bp
  • T to G, chromosome 8 at 13,073,630 bp
  • C to A, chromosome 8 at 87,782,710 bp
  • A to T, chromosome 8 at 88,729,510 bp
  • G to C, chromosome 8 at 94,632,119 bp
  • T to C, chromosome 9 at 38,665,768 bp
  • A to G, chromosome 9 at 45,125,619 bp
  • C to T, chromosome 9 at 108,915,027 bp
  • A to C, chromosome 10 at 23,960,903 bp
  • C to T, chromosome 10 at 25,443,776 bp
  • A to G, chromosome 10 at 43,532,937 bp
  • A to T, chromosome 10 at 60,410,910 bp
  • T to A, chromosome 10 at 84,680,387 bp
  • A to T, chromosome 10 at 110,962,379 bp
  • T to C, chromosome 11 at 29,460,860 bp
  • C to A, chromosome 11 at 55,001,282 bp
  • T to A, chromosome 11 at 67,342,485 bp
  • A to T, chromosome 11 at 94,481,781 bp
  • G to A, chromosome 11 at 102,868,621 bp
  • AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA to AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA, chromosome 12 at 51,887,919 bp
  • A to G, chromosome 12 at 118,190,804 bp
  • T to A, chromosome 13 at 15,715,034 bp
  • A to G, chromosome 13 at 22,475,252 bp
  • T to A, chromosome 13 at 47,228,976 bp
  • T to C, chromosome 14 at 59,229,952 bp
  • T to C, chromosome 15 at 99,947,142 bp
  • G to A, chromosome 17 at 27,118,677 bp
  • T to C, chromosome 17 at 34,508,069 bp
  • T to C, chromosome 17 at 71,897,941 bp
  • A to G, chromosome 18 at 4,343,137 bp
  • A to G, chromosome 18 at 7,440,430 bp
  • T to C, chromosome 18 at 35,653,986 bp
  • A to T, chromosome 18 at 37,321,076 bp
  • T to C, chromosome 19 at 23,988,494 bp
  • A to T, chromosome 19 at 31,764,746 bp
  • A to T, chromosome 19 at 47,748,017 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8676 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068531-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.