Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8676Btlr/Mmmh
Stock Number:
068531-MU
Citation ID:
RRID:MMRRC_068531-MU
Other Names:
R8676 (G1)
Major Collection:

Strain Information

Zdhhc17
Name: zinc finger, DHHC domain containing 17
Synonyms: A230053P19Rik, D130071N24Rik, Hip14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320150
VEGA: 10
Homologene: 56324
Zfp423
Name: zinc finger protein 423
Synonyms: Roaz, ataxia1, Zfp104, Ebfaz
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94187
Homologene: 9010
Epb41l2
Name: erythrocyte membrane protein band 4.1 like 2
Synonyms: NBL2, 4.1G, D10Ertd398e, Epb4.1l2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13822
VEGA: 10
HGNC: HGNC:3379
Homologene: 37478
Adipor2
Name: adiponectin receptor 2
Synonyms: 1110001I14Rik, D6Ucla1e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68465
Homologene: 56119
Map3k8
Name: mitogen-activated protein kinase kinase kinase 8
Synonyms: Cot, Tpl2, c-COT, Tpl-2, Cot/Tpl2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 26410
HGNC: HGNC:6860
Homologene: 3812
Bnc2
Name: basonuclin zinc finger protein 2
Synonyms: 5031434M05Rik, 8430420F16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242509
Homologene: 18243
Rcbtb1
Name: regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Synonyms: 5430409I18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71330
Homologene: 10061
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 60,379,420 bp
  • T to A, chromosome 2 at 85,849,902 bp
  • A to T, chromosome 3 at 3,643,073 bp
  • CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC to CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC, chromosome 3 at 93,446,708 bp
  • A to G, chromosome 3 at 107,036,592 bp
  • T to C, chromosome 4 at 84,276,313 bp
  • A to T, chromosome 4 at 94,849,837 bp
  • A to G, chromosome 4 at 107,895,599 bp
  • C to A, chromosome 4 at 118,735,038 bp
  • G to A, chromosome 4 at 144,670,113 bp
  • T to A, chromosome 5 at 37,457,159 bp
  • T to C, chromosome 5 at 87,411,822 bp
  • A to C, chromosome 5 at 109,053,760 bp
  • A to G, chromosome 5 at 146,482,427 bp
  • C to A, chromosome 6 at 24,755,827 bp
  • C to T, chromosome 6 at 57,322,829 bp
  • G to T, chromosome 6 at 119,363,486 bp
  • A to T, chromosome 6 at 137,830,204 bp
  • A to G, chromosome 7 at 18,794,065 bp
  • T to C, chromosome 7 at 29,934,654 bp
  • T to C, chromosome 7 at 35,602,584 bp
  • A to T, chromosome 7 at 42,662,840 bp
  • C to A, chromosome 7 at 44,591,596 bp
  • C to A, chromosome 7 at 56,188,613 bp
  • T to A, chromosome 7 at 119,775,169 bp
  • T to G, chromosome 8 at 13,073,630 bp
  • C to A, chromosome 8 at 87,782,710 bp
  • A to T, chromosome 8 at 88,729,510 bp
  • G to C, chromosome 8 at 94,632,119 bp
  • T to C, chromosome 9 at 38,665,768 bp
  • A to G, chromosome 9 at 45,125,619 bp
  • C to T, chromosome 9 at 108,915,027 bp
  • A to C, chromosome 10 at 23,960,903 bp
  • C to T, chromosome 10 at 25,443,776 bp
  • A to G, chromosome 10 at 43,532,937 bp
  • A to T, chromosome 10 at 60,410,910 bp
  • T to A, chromosome 10 at 84,680,387 bp
  • A to T, chromosome 10 at 110,962,379 bp
  • T to C, chromosome 11 at 29,460,860 bp
  • C to A, chromosome 11 at 55,001,282 bp
  • T to A, chromosome 11 at 67,342,485 bp
  • A to T, chromosome 11 at 94,481,781 bp
  • G to A, chromosome 11 at 102,868,621 bp
  • AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGTGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA to AGCACACTGCAGGAAGCTCACACAGCACAGCATACCTTCAGGAGAGCACACTGCAGGAAGCTCA, chromosome 12 at 51,887,919 bp
  • A to G, chromosome 12 at 118,190,804 bp
  • T to A, chromosome 13 at 15,715,034 bp
  • A to G, chromosome 13 at 22,475,252 bp
  • T to A, chromosome 13 at 47,228,976 bp
  • T to C, chromosome 14 at 59,229,952 bp
  • T to C, chromosome 15 at 99,947,142 bp
  • G to A, chromosome 17 at 27,118,677 bp
  • T to C, chromosome 17 at 34,508,069 bp
  • T to C, chromosome 17 at 71,897,941 bp
  • A to G, chromosome 18 at 4,343,137 bp
  • A to G, chromosome 18 at 7,440,430 bp
  • T to C, chromosome 18 at 35,653,986 bp
  • A to T, chromosome 18 at 37,321,076 bp
  • T to C, chromosome 19 at 23,988,494 bp
  • A to T, chromosome 19 at 31,764,746 bp
  • A to T, chromosome 19 at 47,748,017 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8676 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068531-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.