Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8724Btlr/Mmmh
Stock Number:
068573-MU
Citation ID:
RRID:MMRRC_068573-MU
Other Names:
R8724 (G1)
Major Collection:

Strain Information

Zfp143
Name: zinc finger protein 143
Synonyms: D7Ertd805e, pHZ-1, KRAB14, Zfp79, Zfp80-rs1, Staf
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20841
Homologene: 56444
Htr3a
Name: 5-hydroxytryptamine (serotonin) receptor 3A
Synonyms: 5-HT3 receptor
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15561
VEGA: 9
HGNC: HGNC:5297
Homologene: 671
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Eya1
Name: EYA transcriptional coactivator and phosphatase 1
Synonyms: bor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14048
HGNC: HGNC:3519
Homologene: 74943
Pcdh9
Name: protocadherin 9
Synonyms: C630029H24Rik, 1500001L12Rik, LOC382930, A730003J17Rik, C530050I23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211712
HGNC: HGNC:8661
Homologene: 10698
Smyd1
Name: SET and MYND domain containing 1
Synonyms: Bop, 4632404M21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12180
Homologene: 7645
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 14,208,982 bp
  • A to C, chromosome 1 at 38,088,069 bp
  • T to G, chromosome 1 at 40,584,141 bp
  • T to A, chromosome 1 at 45,817,400 bp
  • T to A, chromosome 1 at 69,577,941 bp
  • T to G, chromosome 1 at 80,592,627 bp
  • A to T, chromosome 1 at 93,768,301 bp
  • A to G, chromosome 1 at 94,041,231 bp
  • A to G, chromosome 1 at 135,254,360 bp
  • A to G, chromosome 1 at 151,775,873 bp
  • T to A, chromosome 1 at 172,279,378 bp
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • C to T, chromosome 2 at 11,299,973 bp
  • T to C, chromosome 2 at 30,033,949 bp
  • T to A, chromosome 2 at 87,252,360 bp
  • A to T, chromosome 2 at 89,752,029 bp
  • T to C, chromosome 2 at 90,746,753 bp
  • T to C, chromosome 2 at 125,360,146 bp
  • G to A, chromosome 3 at 36,890,893 bp
  • C to T, chromosome 3 at 40,813,587 bp
  • C to T, chromosome 3 at 95,677,116 bp
  • C to A, chromosome 3 at 108,080,116 bp
  • A to T, chromosome 3 at 126,943,756 bp
  • A to G, chromosome 4 at 99,929,767 bp
  • A to G, chromosome 4 at 120,286,912 bp
  • A to G, chromosome 4 at 136,771,057 bp
  • A to C, chromosome 5 at 53,135,823 bp
  • A to C, chromosome 6 at 61,311,215 bp
  • T to A, chromosome 6 at 71,216,783 bp
  • G to A, chromosome 6 at 139,967,893 bp
  • G to A, chromosome 7 at 29,117,377 bp
  • T to C, chromosome 7 at 43,355,552 bp
  • G to A, chromosome 7 at 49,491,436 bp
  • T to C, chromosome 7 at 110,081,903 bp
  • T to C, chromosome 8 at 40,998,463 bp
  • T to A, chromosome 8 at 67,491,791 bp
  • T to C, chromosome 8 at 91,115,209 bp
  • C to A, chromosome 8 at 104,966,323 bp
  • G to A, chromosome 9 at 20,594,056 bp
  • T to G, chromosome 9 at 21,794,621 bp
  • T to A, chromosome 9 at 44,405,263 bp
  • T to C, chromosome 9 at 48,904,681 bp
  • G to T, chromosome 9 at 50,649,667 bp
  • T to C, chromosome 9 at 64,948,171 bp
  • T to C, chromosome 10 at 5,083,861 bp
  • C to T, chromosome 10 at 40,841,484 bp
  • G to A, chromosome 10 at 80,638,926 bp
  • A to G, chromosome 11 at 29,693,316 bp
  • A to T, chromosome 11 at 31,101,120 bp
  • T to C, chromosome 11 at 55,282,960 bp
  • T to C, chromosome 11 at 69,673,593 bp
  • A to G, chromosome 12 at 17,283,981 bp
  • T to C, chromosome 14 at 21,746,407 bp
  • G to A, chromosome 14 at 47,693,878 bp
  • T to A, chromosome 14 at 73,513,809 bp
  • T to C, chromosome 14 at 75,332,072 bp
  • A to G, chromosome 14 at 93,887,147 bp
  • T to A, chromosome 15 at 11,012,524 bp
  • C to T, chromosome 15 at 76,497,799 bp
  • C to T, chromosome 16 at 23,927,314 bp
  • C to T, chromosome 16 at 63,583,455 bp
  • C to CA, chromosome 17 at 6,084,558 bp
  • T to A, chromosome 17 at 12,892,816 bp
  • T to A, chromosome 17 at 56,205,867 bp
  • T to C, chromosome 17 at 91,237,136 bp
  • C to T, chromosome 18 at 37,715,093 bp
  • A to T, chromosome 18 at 53,723,127 bp
  • A to G, chromosome 19 at 5,715,858 bp
  • G to A, chromosome 19 at 34,018,720 bp
  • T to A, chromosome 19 at 34,938,746 bp
  • A to G, chromosome 19 at 50,151,220 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8724 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068573-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.