Strain Name:
C57BL/6J-MtgxR8724Btlr/Mmmh
Stock Number:
068573-MU
Citation ID:
RRID:MMRRC_068573-MU
Other Names:
R8724 (G1)
Major Collection:

Strain Information

Zfp143
Name: zinc finger protein 143
Synonyms: D7Ertd805e, pHZ-1, KRAB14, Zfp79, Zfp80-rs1, Staf
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20841
Homologene: 56444
Htr3a
Name: 5-hydroxytryptamine (serotonin) receptor 3A
Synonyms: 5-HT3 receptor
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15561
VEGA: 9
HGNC: HGNC:5297
Homologene: 671
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Eya1
Name: EYA transcriptional coactivator and phosphatase 1
Synonyms: bor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14048
HGNC: HGNC:3519
Homologene: 74943
Pcdh9
Name: protocadherin 9
Synonyms: C630029H24Rik, 1500001L12Rik, LOC382930, A730003J17Rik, C530050I23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211712
HGNC: HGNC:8661
Homologene: 10698
Smyd1
Name: SET and MYND domain containing 1
Synonyms: Bop, 4632404M21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12180
Homologene: 7645
Fmn2
Name: formin 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54418
Homologene: 137334
Plk4
Name: polo like kinase 4
Synonyms: Sak, Stk18
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20873
Homologene: 7962
Kif20b
Name: kinesin family member 20B
Synonyms: N-6 kinesin, C330014J10Rik, Kif20b, Mphosph1, 33cex, magoo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Rtn4
Name: reticulon 4
Synonyms: 1110020G17Rik, C130026I10Rik, NOGO, NgA, Nogo-B, Nogo-A
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68585
Homologene: 10743
Rev1
Name: REV1, DNA directed polymerase
Synonyms: REV1, 1110027I23Rik, Rev1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56210
Homologene: 32309
Zc3h13
Name: zinc finger CCCH type containing 13
Synonyms: C87618, 4930570G11Rik, 2600010B19Rik, 3110050K21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67302
VEGA: 14
Fnbp4
Name: formin binding protein 4
Synonyms: FBP30
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 55935
Homologene: 9087
Cdc40
Name: cell division cycle 40
Synonyms: PRP17, EHB3, 1200003H23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71713
VEGA: 10
Homologene: 5716
Med4
Name: mediator complex subunit 4
Synonyms: HSPC126, p36 TRAP/SMCC/PC2 subunit, DRIP36, 2410046H15Rik, MED4, TRAP36, Vdrip
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67381
VEGA: 14
Homologene: 8568
Bltp1
Name: bridge-like lipid transfer protein family member 1
Synonyms: Tweek, FSA, 4932438A13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229227
Homologene: 52105
Nav2
Name: neuron navigator 2
Synonyms: POMFIL2, Unc53H2, HELAD1, RAINB2, 5330421F07Rik, Rainb1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78286
Homologene: 52330
Kank2
Name: KN motif and ankyrin repeat domains 2
Synonyms: Ankrd25
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235041
VEGA: 9
Homologene: 9163
Senp3
Name: SUMO/sentrin specific peptidase 3
Synonyms: Smt3ip1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 80886
Homologene: 9236
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Trappc4
Name: trafficking protein particle complex 4
Synonyms: Sbd, 1500017G03Rik, HSPC172, PTD009, TRS23, Sbdn
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 60409
VEGA: 9
Homologene: 105453
Hsf1
Name: heat shock factor 1
Synonyms: heat shock transcription factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15499
VEGA: 15
HGNC: HGNC:5224
Homologene: 74556
Prkcq
Name: protein kinase C, theta
Synonyms: PKC-0, Pkcq, A130035A12Rik, PKC-theta, PKC theta, PKCtheta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18761
HGNC: HGNC:9410
Homologene: 21263
Cep120
Name: centrosomal protein 120
Synonyms: Ccdc100
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225523
VEGA: 18
Homologene: 27415
Zfp846
Name: zinc finger protein 846
Synonyms: 2210010B09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244721
Homologene: 87243
Ampd2
Name: adenosine monophosphate deaminase 2
Synonyms: Ampd-2, 1200014F01Rik, m4521Dajl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109674
HGNC: HGNC:469
Homologene: 2979
Rbl2
Name: RB transcriptional corepressor like 2
Synonyms: Rb2, p130, retinoblastoma-like 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19651
HGNC: HGNC:9894
Homologene: 4098
Edem3
Name: ER degradation enhancer, mannosidase alpha-like 3
Synonyms: 2310050N11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66967
Homologene: 11866
Dync2i2
Name: dynein 2 intermediate chain 2
Synonyms: 3200002I06Rik, Wdr34
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71820
Homologene: 14156
Csnk1g2
Name: casein kinase 1, gamma 2
Synonyms: 2810429I12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103236
VEGA: 10
HGNC: HGNC:2455
Homologene: 100845
Wdr75
Name: WD repeat domain 75
Synonyms: 1300003A18Rik, 2410118I19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73674
Homologene: 32771
Mtus1
Name: mitochondrial tumor suppressor 1
Synonyms: MD44, MTSG1, Atip1, B430305I03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102103
Homologene: 100292
Dlat
Name: dihydrolipoamide S-acetyltransferase
Synonyms: PDC-E2, 6332404G05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235339
HGNC: HGNC:2896
Homologene: 6814
Dpp9
Name: dipeptidylpeptidase 9
Synonyms: DPRP2, 6430584G11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224897
VEGA: 17
Homologene: 16385
Siglecf
Name: sialic acid binding Ig-like lectin F
Synonyms: mSiglec-F, Siglec5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233186
Homologene: 50482
Slc9a4
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 4
Synonyms: NHE4, D730009J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 110895
Homologene: 72232
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Pdcd1
Name: programmed cell death 1
Synonyms: PD-1, Pdc1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18566
HGNC: HGNC:8760
Homologene: 3681
Slc45a2
Name: solute carrier family 45, member 2
Synonyms: Dbr, bls, Aim1, Aim-1, dominant brown, blanc-sale, Matp, Oca4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22293
Homologene: 9412
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Elf3
Name: E74-like factor 3
Synonyms: jen, ESX, ESE-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13710
HGNC: HGNC:3318
Homologene: 3265
Sorcs1
Name: sortilin-related VPS10 domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58178
Homologene: 10967
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Epha3
Name: Eph receptor A3
Synonyms: Tyro4, Mek4, Hek4, Hek, Cek4, End3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13837
VEGA: 16
HGNC: HGNC:3387
Homologene: 21083
Pik3c2g
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18705
HGNC: HGNC:8973
Homologene: 3362
Ephb2
Name: Eph receptor B2
Synonyms: eteck, Erk, Tyro5, Prkm5, Nuk, Drt, Hek5, Sek3, Qek5, Cek5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13844
HGNC: HGNC:3393
Homologene: 37925
Or4a80
Name: olfactory receptor family 4 subfamily A member 80
Synonyms: MOR231-19P, GA_x6K02T2Q125-51193814-51192857, MOR231-19P, MOR231-18, Olfr1253-ps1, Olfr1559-ps1, Olfr1253
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258370
Dock10
Name: dedicator of cytokinesis 10
Synonyms: Jr5, Jr4, ZIZ3, 9330153B10Rik, A630054M16Rik, Zizimin3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210293
Homologene: 45952
Ccser1
Name: coiled-coil serine rich 1
Synonyms: 6230405M12Rik, C130092O11Rik, Fam190a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232035
Homologene: 28086
Pnldc1
Name: poly(A)-specific ribonuclease (PARN)-like domain containing 1
Synonyms: LOC240023
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240023
VEGA: 17
Homologene: 15054
Ces2g
Name: carboxylesterase 2G
Synonyms: 2210023G05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72361
HGNC: HGNC:1864
Homologene: 77154
Atg4b
Name: autophagy related 4B, cysteine peptidase
Synonyms: Apg4b, 2510009N07Rik, autophagin 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66615
Homologene: 100868
Sel1l3
Name: sel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms: 2310045A20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231238
Homologene: 9054
Slc24a1
Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214111
VEGA: 9
Homologene: 3472
Adamtsl4
Name: ADAMTS-like 4
Synonyms: Tsrc1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229595
Homologene: 23141
Atp1a2
Name: ATPase, Na+/K+ transporting, alpha 2 polypeptide
Synonyms: Atpa-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98660
HGNC: HGNC:800
Homologene: 47947
Or10ag53
Name: olfactory receptor family 10 subfamily AG member 53
Synonyms: GA_x6K02T2Q125-48736906-48737886, MOR273-4P, MOR264-20, MOR273-4P, Olfr1530-ps1, Olfr1115
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258294
Homologene: 27114
Lipk
Name: lipase, family member K
Synonyms: Lipl2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240633
VEGA: 19
Homologene: 75666
Foxo6
Name: forkhead box O6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329934
Homologene: 82395
Ehbp1l1
Name: EH domain binding protein 1-like 1
Synonyms: G430002G23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 114601
VEGA: 19
Homologene: 136059
Pgm1
Name: phosphoglucomutase 1
Synonyms: Pgm-2, 2610020G18Rik, Pgm1a, Pgm2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72157
HGNC: HGNC:8905
Homologene: 1979
Nat1
Name: N-acetyl transferase 1
Synonyms: Nat-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17960
Homologene: 115468
Asb3
Name: ankyrin repeat and SOCS box-containing 3
Synonyms: 2400011J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 65257
Homologene: 9391
Dusp13b
Name: dual specificity phosphatase 13B
Synonyms: TMDP, LMW-DSP6, TS-DSP6, LOC382853, Dusp13
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 27389
Homologene: 121602
Ikzf2
Name: IKAROS family zinc finger 2
Synonyms: Helios, Zfpn1a2, A730095J18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22779
Homologene: 22659
Rtp2
Name: receptor transporter protein 2
Synonyms: LOC224055
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224055
VEGA: 16
Homologene: 19503
Gm6741
Name: predicted gene 6741
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627235
VEGA: 17
Pdia6
Name: protein disulfide isomerase associated 6
Synonyms: CaBP5, P5, 1700015E05Rik, Txndc7
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71853
Homologene: 4198
Gtf2h5
Name: general transcription factor IIH, polypeptide 5
Synonyms: 2700017P07Rik, 2810432H05Rik, D17Wsu155e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66467
Homologene: 45635
Pcdhga7
Name: protocadherin gamma subfamily A, 7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93715
HGNC: HGNC:8705
Homologene: 36377
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 14,208,982 bp
  • A to C, chromosome 1 at 38,088,069 bp
  • T to G, chromosome 1 at 40,584,141 bp
  • T to A, chromosome 1 at 45,817,400 bp
  • T to A, chromosome 1 at 69,577,941 bp
  • T to G, chromosome 1 at 80,592,627 bp
  • A to T, chromosome 1 at 93,768,301 bp
  • A to G, chromosome 1 at 94,041,231 bp
  • A to G, chromosome 1 at 135,254,360 bp
  • A to G, chromosome 1 at 151,775,873 bp
  • T to A, chromosome 1 at 172,279,378 bp
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • C to T, chromosome 2 at 11,299,973 bp
  • T to C, chromosome 2 at 30,033,949 bp
  • T to A, chromosome 2 at 87,252,360 bp
  • A to T, chromosome 2 at 89,752,029 bp
  • T to C, chromosome 2 at 90,746,753 bp
  • T to C, chromosome 2 at 125,360,146 bp
  • G to A, chromosome 3 at 36,890,893 bp
  • C to T, chromosome 3 at 40,813,587 bp
  • C to T, chromosome 3 at 95,677,116 bp
  • C to A, chromosome 3 at 108,080,116 bp
  • A to T, chromosome 3 at 126,943,756 bp
  • A to G, chromosome 4 at 99,929,767 bp
  • A to G, chromosome 4 at 120,286,912 bp
  • A to G, chromosome 4 at 136,771,057 bp
  • A to C, chromosome 5 at 53,135,823 bp
  • A to C, chromosome 6 at 61,311,215 bp
  • T to A, chromosome 6 at 71,216,783 bp
  • G to A, chromosome 6 at 139,967,893 bp
  • G to A, chromosome 7 at 29,117,377 bp
  • T to C, chromosome 7 at 43,355,552 bp
  • G to A, chromosome 7 at 49,491,436 bp
  • T to C, chromosome 7 at 110,081,903 bp
  • T to C, chromosome 8 at 40,998,463 bp
  • T to A, chromosome 8 at 67,491,791 bp
  • T to C, chromosome 8 at 91,115,209 bp
  • C to A, chromosome 8 at 104,966,323 bp
  • G to A, chromosome 9 at 20,594,056 bp
  • T to G, chromosome 9 at 21,794,621 bp
  • T to A, chromosome 9 at 44,405,263 bp
  • T to C, chromosome 9 at 48,904,681 bp
  • G to T, chromosome 9 at 50,649,667 bp
  • T to C, chromosome 9 at 64,948,171 bp
  • T to C, chromosome 10 at 5,083,861 bp
  • C to T, chromosome 10 at 40,841,484 bp
  • G to A, chromosome 10 at 80,638,926 bp
  • A to G, chromosome 11 at 29,693,316 bp
  • A to T, chromosome 11 at 31,101,120 bp
  • T to C, chromosome 11 at 55,282,960 bp
  • T to C, chromosome 11 at 69,673,593 bp
  • A to G, chromosome 12 at 17,283,981 bp
  • T to C, chromosome 14 at 21,746,407 bp
  • G to A, chromosome 14 at 47,693,878 bp
  • T to A, chromosome 14 at 73,513,809 bp
  • T to C, chromosome 14 at 75,332,072 bp
  • A to G, chromosome 14 at 93,887,147 bp
  • T to A, chromosome 15 at 11,012,524 bp
  • C to T, chromosome 15 at 76,497,799 bp
  • C to T, chromosome 16 at 23,927,314 bp
  • C to T, chromosome 16 at 63,583,455 bp
  • C to CA, chromosome 17 at 6,084,558 bp
  • T to A, chromosome 17 at 12,892,816 bp
  • T to A, chromosome 17 at 56,205,867 bp
  • T to C, chromosome 17 at 91,237,136 bp
  • C to T, chromosome 18 at 37,715,093 bp
  • A to T, chromosome 18 at 53,723,127 bp
  • A to G, chromosome 19 at 5,715,858 bp
  • G to A, chromosome 19 at 34,018,720 bp
  • T to A, chromosome 19 at 34,938,746 bp
  • A to G, chromosome 19 at 50,151,220 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8724 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068573-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.