Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8753Btlr/Mmmh
Stock Number:
068619-MU
Citation ID:
RRID:MMRRC_068619-MU
Other Names:
R8753 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: polycystin-1, PC1, PC-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Polr3e
Name: polymerase (RNA) III (DNA directed) polypeptide E
Synonyms: RPC5, Sin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26939
Homologene: 14052
Mbtps1
Name: membrane-bound transcription factor peptidase, site 1
Synonyms: subtilisin/kexin isozyme-1, SKI-1, S1P, 0610038M03Rik, site-1 protease
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56453
Homologene: 2808
Ccz1
Name: CCZ1 vacuolar protein trafficking and biogenesis associated
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231874
Homologene: 56717
Tcf7l2
Name: transcription factor 7 like 2, T cell specific, HMG box
Synonyms: TCF4E, TCF4B, mTcf-4E, mTcf-4B, Tcf-4, Tcf4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21416
Homologene: 7564
Zc3h14
Name: zinc finger CCCH type containing 14
Synonyms: 1700016A15Rik, 1010001P15Rik, 2700069A02Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75553
VEGA: 12
Homologene: 32605
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 6,845,791 bp
  • A to G, chromosome 1 at 39,718,440 bp
  • A to T, chromosome 1 at 60,268,383 bp
  • C to G, chromosome 1 at 90,767,606 bp
  • A to G, chromosome 1 at 159,850,366 bp
  • A to T, chromosome 1 at 173,473,657 bp
  • A to T, chromosome 2 at 13,308,566 bp
  • T to C, chromosome 2 at 25,442,694 bp
  • C to G, chromosome 2 at 84,348,315 bp
  • C to A, chromosome 2 at 84,348,317 bp
  • C to T, chromosome 2 at 101,741,378 bp
  • A to T, chromosome 2 at 112,110,457 bp
  • T to C, chromosome 3 at 55,626,908 bp
  • T to G, chromosome 3 at 96,651,155 bp
  • C to A, chromosome 3 at 108,080,116 bp
  • A to G, chromosome 3 at 122,280,749 bp
  • T to C, chromosome 4 at 19,841,443 bp
  • A to T, chromosome 4 at 115,574,961 bp
  • T to C, chromosome 4 at 134,548,019 bp
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp
  • CCTGCTGCTGCTGCTG to CCTGCTGCTGCTG, chromosome 5 at 90,786,212 bp
  • A to G, chromosome 5 at 113,078,381 bp
  • A to G, chromosome 5 at 143,988,232 bp
  • C to G, chromosome 6 at 56,883,692 bp
  • A to T, chromosome 6 at 57,258,910 bp
  • T to G, chromosome 7 at 49,452,572 bp
  • G to A, chromosome 7 at 79,098,768 bp
  • A to T, chromosome 7 at 92,859,460 bp
  • T to A, chromosome 7 at 100,399,817 bp
  • T to A, chromosome 7 at 103,787,360 bp
  • T to C, chromosome 7 at 120,940,317 bp
  • T to C, chromosome 8 at 13,222,118 bp
  • T to C, chromosome 8 at 86,848,457 bp
  • T to C, chromosome 8 at 119,508,862 bp
  • A to T, chromosome 8 at 125,887,260 bp
  • A to G, chromosome 9 at 4,385,013 bp
  • G to T, chromosome 9 at 50,649,667 bp
  • G to A, chromosome 9 at 65,316,676 bp
  • T to C, chromosome 9 at 85,728,766 bp
  • C to T, chromosome 10 at 40,841,484 bp
  • T to C, chromosome 10 at 61,749,334 bp
  • G to A, chromosome 10 at 128,483,201 bp
  • A to T, chromosome 11 at 33,275,953 bp
  • A to G, chromosome 11 at 54,510,041 bp
  • A to G, chromosome 11 at 72,051,878 bp
  • G to T, chromosome 11 at 73,244,256 bp
  • A to G, chromosome 11 at 119,210,666 bp
  • G to T, chromosome 12 at 70,195,626 bp
  • A to T, chromosome 12 at 98,758,572 bp
  • A to T, chromosome 13 at 23,163,021 bp
  • C to A, chromosome 14 at 24,463,634 bp
  • T to A, chromosome 14 at 26,652,959 bp
  • T to C, chromosome 14 at 55,887,766 bp
  • T to C, chromosome 15 at 89,295,459 bp
  • A to T, chromosome 16 at 44,500,412 bp
  • T to A, chromosome 16 at 58,678,028 bp
  • C to CA, chromosome 17 at 6,084,558 bp
  • T to C, chromosome 17 at 8,396,645 bp
  • A to G, chromosome 17 at 24,574,202 bp
  • T to G, chromosome 18 at 35,619,578 bp
  • T to C, chromosome 19 at 6,855,845 bp
  • C to T, chromosome 19 at 17,469,044 bp
  • T to C, chromosome 19 at 55,931,763 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8753 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068619-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.