Strain Name:
C57BL/6J-MtgxR8753Btlr/Mmmh
Stock Number:
068619-MU
Citation ID:
RRID:MMRRC_068619-MU
Other Names:
R8753 (G1)
Major Collection:

Strain Information

Pkd1
Name: polycystin 1, transient receptor potential channel interacting
Synonyms: PC-1, PC1, polycystin-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18763
VEGA: 17
HGNC: HGNC:9008
Homologene: 250
Polr3e
Name: polymerase (RNA) III (DNA directed) polypeptide E
Synonyms: Sin, RPC5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26939
Homologene: 14052
Mbtps1
Name: membrane-bound transcription factor peptidase, site 1
Synonyms: S1P, SKI-1, 0610038M03Rik, site-1 protease, subtilisin/kexin isozyme-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56453
Homologene: 2808
Ccz1
Name: CCZ1 vacuolar protein trafficking and biogenesis associated
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231874
Homologene: 56717
Tcf7l2
Name: transcription factor 7 like 2, T cell specific, HMG box
Synonyms: Tcf-4, Tcf4, mTcf-4B, mTcf-4E, TCF4B, TCF4E
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21416
Homologene: 7564
Zc3h14
Name: zinc finger CCCH type containing 14
Synonyms: 1700016A15Rik, 2700069A02Rik, 1010001P15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75553
VEGA: 12
Homologene: 32605
Cdc40
Name: cell division cycle 40
Synonyms: PRP17, EHB3, 1200003H23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71713
VEGA: 10
Homologene: 5716
Polr3a
Name: polymerase (RNA) III (DNA directed) polypeptide A
Synonyms: 9330175N20Rik, RPC155, RPC1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218832
VEGA: 14
Homologene: 5124
Nav2
Name: neuron navigator 2
Synonyms: RAINB2, POMFIL2, Unc53H2, HELAD1, 5330421F07Rik, Rainb1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78286
Homologene: 52330
Arf4
Name: ADP-ribosylation factor 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11843
HGNC: HGNC:655
Homologene: 55593
Ddias
Name: DNA damage-induced apoptosis suppressor
Synonyms: noxin, 4632434I11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74041
Homologene: 51655
C2cd3
Name: C2 calcium-dependent domain containing 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277939
Homologene: 19524
Dnttip2
Name: deoxynucleotidyltransferase, terminal, interacting protein 2
Synonyms: 4930588M11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99480
Homologene: 124162
Nt5c3
Name: 5'-nucleotidase, cytosolic III
Synonyms: 1600024P05Rik, PSN1, 2610206B05Rik, Umph1, cN-III, PN-1, p36, Umph-1, lupin, PN-I
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107569
Homologene: 9534
Sbf1
Name: SET binding factor 1
Synonyms: B230113C15Rik, 2610510A08Rik, Mtmr5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77980
Homologene: 84710
Boc
Name: BOC cell adhesion associated, oncogene regulated
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 117606
Homologene: 32819
Ampd2
Name: adenosine monophosphate deaminase 2
Synonyms: Ampd-2, 1200014F01Rik, m4521Dajl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109674
HGNC: HGNC:469
Homologene: 2979
Ibtk
Name: inhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms: 5430411K16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108837
Homologene: 34661
N4bp1
Name: NEDD4 binding protein 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 80750
Homologene: 23703
Dlat
Name: dihydrolipoamide S-acetyltransferase
Synonyms: 6332404G05Rik, PDC-E2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235339
HGNC: HGNC:2896
Homologene: 6814
Nbeal1
Name: neurobeachin like 1
Synonyms: ALS2CR17, 2310076G13Rik, A530083I02Rik, A530050O19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Fnip1
Name: folliculin interacting protein 1
Synonyms: A730024A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216742
Homologene: 28173
Trpv1
Name: transient receptor potential cation channel, subfamily V, member 1
Synonyms: VR-1, Vr1, OTRPC1, capsaicin receptor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193034
Homologene: 12920
Smarcc2
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
Synonyms: 5930405J04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68094
VEGA: 10
Homologene: 2312
Macroh2a2
Name: macroH2A.2 histone
Synonyms: H2afy2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 404634
Homologene: 10246
Cubn
Name: cubilin
Synonyms: intrinsic factor-cobalamin receptor, D2Wsu88e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65969
HGNC: HGNC:2548
Homologene: 37434
Rfx8
Name: regulatory factor X 8
Synonyms: 4933400N17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 619289
Homologene: 82436
Tnr
Name: tenascin R
Synonyms: TN-R, janusin, J1-tenascin, restrictin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21960
Homologene: 124416
Pcsk5
Name: proprotein convertase subtilisin/kexin type 5
Synonyms: SPC6, b2b585Clo, PC6, b2b1549Clo, PC5A, PC5/6A
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18552
VEGA: 19
HGNC: HGNC:8747
Homologene: 21244
Calcrl
Name: calcitonin receptor-like
Synonyms: CRLR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54598
Homologene: 21179
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Ccdc88b
Name: coiled-coil domain containing 88B
Synonyms: 2610041P08Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78317
VEGA: 19
Homologene: 49992
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Ifi206
Name: interferon activated gene 206
Synonyms: Gm4955, Pyblhin-C
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 102639543
HGNC: HGNC:5395
Homologene: 115929
St18
Name: suppression of tumorigenicity 18
Synonyms: Nzf3, Myt3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240690
Homologene: 8792
Pygl
Name: liver glycogen phosphorylase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110095
HGNC: HGNC:9725
Homologene: 84371
Pitpnm3
Name: PITPNM family member 3
Synonyms: Ackr6, A330068P14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327958
Homologene: 66271
Pcnx2
Name: pecanex homolog 2
Synonyms: Pcnxl2, E330039K12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270109
HGNC: HGNC:8736
Homologene: 8987
Tbc1d16
Name: TBC1 domain family, member 16
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207592
Homologene: 10380
Crybb3
Name: crystallin, beta B3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12962
HGNC: HGNC:2400
Homologene: 3008
Abca2
Name: ATP-binding cassette, sub-family A member 2
Synonyms: D2H0S1474E, Abc2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11305
HGNC: HGNC:32
Homologene: 55590
Slc7a13
Name: solute carrier family 7, (cationic amino acid transporter, y+ system) member 13
Synonyms: XAT2, AGT-1, AGT1, 0610009O04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74087
Homologene: 23656
Itga10
Name: integrin, alpha 10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213119
HGNC: HGNC:6135
Homologene: 2697
Clpx
Name: caseinolytic mitochondrial matrix peptidase chaperone subunit
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270166
HGNC: HGNC:2088
Homologene: 4851
Adprhl1
Name: ADP-ribosylhydrolase like 1
Synonyms: D330008N11Rik, Arh2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234072
Homologene: 16311
Acan
Name: aggrecan
Synonyms: Cspg1, Agc1, b2b183Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11595
HGNC: HGNC:319
Homologene: 137204
Khnyn
Name: KH and NYN domain containing
Synonyms: 9130227C08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219094
VEGA: 14
Homologene: 23611
Slc23a1
Name: solute carrier family 23 (nucleobase transporters), member 1
Synonyms: YSPL3, SVCT1, D18Ucla2, Slc23a2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20522
Homologene: 40769
Cyp4a31
Name: cytochrome P450, family 4, subfamily a, polypeptide 31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 666168
HGNC: HGNC:2642
Homologene: 128044
Or52z1
Name: olfactory receptor family 52 subfamily Z member 1
Synonyms: 3'[b]1, Olfr67, GA_x6K02T2PBJ9-6515150-6514170, MOR31-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18368
Homologene: 85930
Cpox
Name: coproporphyrinogen oxidase
Synonyms: nct, clone 560, Cpo, M100835, cac
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12892
VEGA: 16
HGNC: HGNC:2321
Homologene: 76
Msantd4
Name: Myb/SANT-like DNA-binding domain containing 4 with coiled-coils
Synonyms: 8430410K20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78100
Homologene: 34935
Vmn1r15
Name: vomeronasal 1 receptor 15
Synonyms: V1rc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113863
Homologene: 123826
Prr5l
Name: proline rich 5 like
Synonyms: 2600010E01Rik, 4833411O04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72446
Homologene: 11753
Vmn1r219
Name: vomeronasal 1 receptor 219
Synonyms: V1rh13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171272
Homologene: 110880
Selenon
Name: selenoprotein N
Synonyms: Sepn1, 1110019I12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74777
Homologene: 10723
Gtf2h5
Name: general transcription factor IIH, polypeptide 5
Synonyms: 2810432H05Rik, 2700017P07Rik, D17Wsu155e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66467
Homologene: 45635
Cxcl3
Name: C-X-C motif chemokine ligand 3
Synonyms: Dcip1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330122
Homologene: 138183
Or4f14c
Name: olfactory receptor family 4 subfamily F member 14C
Synonyms: MOR245-1, GA_x6K02T2Q125-73157028-73156524, Olfr1315
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404497
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 6,845,791 bp
  • A to G, chromosome 1 at 39,718,440 bp
  • A to T, chromosome 1 at 60,268,383 bp
  • C to G, chromosome 1 at 90,767,606 bp
  • A to G, chromosome 1 at 159,850,366 bp
  • A to T, chromosome 1 at 173,473,657 bp
  • A to T, chromosome 2 at 13,308,566 bp
  • T to C, chromosome 2 at 25,442,694 bp
  • C to G, chromosome 2 at 84,348,315 bp
  • C to A, chromosome 2 at 84,348,317 bp
  • C to T, chromosome 2 at 101,741,378 bp
  • A to T, chromosome 2 at 112,110,457 bp
  • T to C, chromosome 3 at 55,626,908 bp
  • T to G, chromosome 3 at 96,651,155 bp
  • C to A, chromosome 3 at 108,080,116 bp
  • A to G, chromosome 3 at 122,280,749 bp
  • T to C, chromosome 4 at 19,841,443 bp
  • A to T, chromosome 4 at 115,574,961 bp
  • T to C, chromosome 4 at 134,548,019 bp
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp
  • CCTGCTGCTGCTGCTG to CCTGCTGCTGCTG, chromosome 5 at 90,786,212 bp
  • A to G, chromosome 5 at 113,078,381 bp
  • A to G, chromosome 5 at 143,988,232 bp
  • C to G, chromosome 6 at 56,883,692 bp
  • A to T, chromosome 6 at 57,258,910 bp
  • T to G, chromosome 7 at 49,452,572 bp
  • G to A, chromosome 7 at 79,098,768 bp
  • A to T, chromosome 7 at 92,859,460 bp
  • T to A, chromosome 7 at 100,399,817 bp
  • T to A, chromosome 7 at 103,787,360 bp
  • T to C, chromosome 7 at 120,940,317 bp
  • T to C, chromosome 8 at 13,222,118 bp
  • T to C, chromosome 8 at 86,848,457 bp
  • T to C, chromosome 8 at 119,508,862 bp
  • A to T, chromosome 8 at 125,887,260 bp
  • A to G, chromosome 9 at 4,385,013 bp
  • G to T, chromosome 9 at 50,649,667 bp
  • G to A, chromosome 9 at 65,316,676 bp
  • T to C, chromosome 9 at 85,728,766 bp
  • C to T, chromosome 10 at 40,841,484 bp
  • T to C, chromosome 10 at 61,749,334 bp
  • G to A, chromosome 10 at 128,483,201 bp
  • A to T, chromosome 11 at 33,275,953 bp
  • A to G, chromosome 11 at 54,510,041 bp
  • A to G, chromosome 11 at 72,051,878 bp
  • G to T, chromosome 11 at 73,244,256 bp
  • A to G, chromosome 11 at 119,210,666 bp
  • G to T, chromosome 12 at 70,195,626 bp
  • A to T, chromosome 12 at 98,758,572 bp
  • A to T, chromosome 13 at 23,163,021 bp
  • C to A, chromosome 14 at 24,463,634 bp
  • T to A, chromosome 14 at 26,652,959 bp
  • T to C, chromosome 14 at 55,887,766 bp
  • T to C, chromosome 15 at 89,295,459 bp
  • A to T, chromosome 16 at 44,500,412 bp
  • T to A, chromosome 16 at 58,678,028 bp
  • C to CA, chromosome 17 at 6,084,558 bp
  • T to C, chromosome 17 at 8,396,645 bp
  • A to G, chromosome 17 at 24,574,202 bp
  • T to G, chromosome 18 at 35,619,578 bp
  • T to C, chromosome 19 at 6,855,845 bp
  • C to T, chromosome 19 at 17,469,044 bp
  • T to C, chromosome 19 at 55,931,763 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8753 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068619-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.