MMRRC:068637-MU

A to C, chromosome 1 at 71,258,089 bp
A to G, chromosome 2 at 40,903,414 bp
G to A, chromosome 2 at 76,822,970 bp
G to A, chromosome 2 at 86,075,174 bp
A to G, chromosome 2 at 163,006,803 bp
G to A, chromosome 2 at 164,786,829 bp
T to A, chromosome 3 at 36,180,196 bp
A to G, chromosome 3 at 87,783,115 bp
A to G, chromosome 3 at 90,669,558 bp
A to G, chromosome 3 at 97,051,103 bp
T to C, chromosome 3 at 97,159,193 bp
C to A, chromosome 4 at 8,838,691 bp
T to A, chromosome 4 at 40,179,037 bp
G to T, chromosome 4 at 112,804,694 bp
A to G, chromosome 4 at 143,133,447 bp
A to G, chromosome 4 at 145,219,915 bp
A to G, chromosome 4 at 155,861,391 bp
A to G, chromosome 5 at 48,302,848 bp
T to A, chromosome 5 at 84,107,991 bp
T to A, chromosome 5 at 108,996,051 bp
T to A, chromosome 5 at 113,263,257 bp
T to C, chromosome 5 at 136,974,497 bp
C to T, chromosome 5 at 150,018,797 bp
T to A, chromosome 6 at 38,698,223 bp
G to T, chromosome 6 at 117,178,592 bp
A to T, chromosome 6 at 123,780,541 bp
A to T, chromosome 6 at 132,657,118 bp
C to A, chromosome 7 at 17,093,889 bp
A to T, chromosome 7 at 56,135,375 bp
T to C, chromosome 7 at 103,906,994 bp
C to T, chromosome 7 at 118,527,417 bp
C to T, chromosome 7 at 141,067,575 bp
C to A, chromosome 8 at 105,773,033 bp
G to T, chromosome 8 at 107,556,557 bp
T to C, chromosome 9 at 45,447,728 bp
A to G, chromosome 9 at 120,955,432 bp
G to A, chromosome 10 at 11,289,576 bp
T to A, chromosome 11 at 6,347,129 bp
G to A, chromosome 11 at 69,589,608 bp
A to C, chromosome 11 at 88,839,672 bp
A to G, chromosome 11 at 97,956,581 bp
A to T, chromosome 12 at 84,413,294 bp
C to T, chromosome 13 at 38,937,746 bp
A to T, chromosome 13 at 51,711,510 bp
A to T, chromosome 13 at 77,066,665 bp
T to C, chromosome 13 at 91,890,566 bp
T to G, chromosome 13 at 95,015,067 bp
T to C, chromosome 13 at 102,783,391 bp
C to T, chromosome 14 at 53,519,770 bp
AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
T to C, chromosome 17 at 18,062,671 bp
A to T, chromosome 17 at 65,772,534 bp
T to A, chromosome 17 at 67,810,151 bp
T to A, chromosome 17 at 87,746,592 bp
T to C, chromosome 18 at 6,226,965 bp
A to T, chromosome 18 at 6,629,482 bp
T to C, chromosome 19 at 5,388,348 bp
A to T, chromosome 19 at 10,872,631 bp

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.

Strain GQC Summary

Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice

Littermates of all relevant genotypes.

Strain Origin

Donor

Bruce Beutler, M.D., University of Texas Southwestern Medical Center.

Primary Reference

MUTAGENETIX record for R8796 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Strain Development

C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Breeding Scheme(s)

When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.

Overall Breeding Performance

Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size

Undetermined

Recommended wean age

3 weeks

Order Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
068637-MU-RESUS	Litter recovered from cryo-archive	$5,475.00 / Non-Profit	Litter	Recovered litter⁴; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Information Expand All