Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8796Btlr/Mmmh
Stock Number:
068637-MU
Citation ID:
RRID:MMRRC_068637-MU
Other Names:
R8796 (G1)
Major Collection:

Strain Information

Trp53
Name: transformation related protein 53
Synonyms: p53, p44
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22059
Homologene: 460
Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Cxcl12
Name: C-X-C motif chemokine ligand 12
Synonyms: Sdf1b, Sdf1a, PBSF/SDF-1, SDF-1, PBSF, TLSF-b, TLSF-a, TPAR1, Sdf1, Scyb12
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20315
Homologene: 128606
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Ntrk1
Name: neurotrophic tyrosine kinase, receptor, type 1
Synonyms: TrkA, Tkr
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18211
HGNC: HGNC:8031
Homologene: 1898
Wwp2
Name: WW domain containing E3 ubiquitin protein ligase 2
Synonyms: 1300010O06Rik, AIP2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66894
Homologene: 48490
Sgsm1
Name: small G protein signaling modulator 1
Synonyms: 2410098H20Rik, D5Bwg1524e, Rutbc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52850
Homologene: 64485
Dscaml1
Name: DS cell adhesion molecule like 1
Synonyms: 4930435C18Rik, 4921507G06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 114873
VEGA: 9
Homologene: 79549
Plxdc1
Name: plexin domain containing 1
Synonyms: Tem7, 2410003I07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72324
Homologene: 10700
Prdm2
Name: PR domain containing 2, with ZNF domain
Synonyms: Riz, Riz1, LOC381568, E330024L24Rik, 4833427P12Rik, KMT8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 110593
HGNC: HGNC:9347
Homologene: 40822
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328329
Homologene: 42094
Kif5b
Name: kinesin family member 5B
Synonyms: Khc, kinesin heavy chain
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16573
HGNC: HGNC:6324
Homologene: 55829
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Ogdh
Name: oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Synonyms: alpha-ketoglutarate dehydrogenase, 2210412K19Rik, 2210403E04Rik, d1401
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18293
HGNC: HGNC:8124
Homologene: 55662
Akap1
Name: A kinase anchor protein 1
Synonyms: S-AKAP84, AKAP84, AKAP121, DAKAP1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11640
HGNC: HGNC:367
Homologene: 31165
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Rab31
Name: RAB31, member RAS oncogene family
Synonyms: 1700093E07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106572
VEGA: 17
HGNC: HGNC:9771
Homologene: 5001
Sema4d
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D
Synonyms: semaphorin H, M-sema G, coll-4, CD100, Semcl2, Semaj, Semacl2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20354
Homologene: 21282
Slf1
Name: SMC5-SMC6 complex localization factor 1
Synonyms: C730024G01Rik, 2700017A04Rik, Brctx, Brctd1, Ankrd32
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105377
Homologene: 13000
Hipk2
Name: homeodomain interacting protein kinase 2
Synonyms: Stank, 1110014O20Rik, B230339E18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15258
Homologene: 68766
Slit2
Name: slit guidance ligand 2
Synonyms: Slil3, Drad-1, E130320P19Rik, E030015M03Rik, b2b1200.1Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20563
Homologene: 3516
Aco1
Name: aconitase 1
Synonyms: Irp1, Irebp, Aco-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11428
HGNC: HGNC:117
Homologene: 1657
Acp6
Name: acid phosphatase 6, lysophosphatidic
Synonyms: 5730559A09Rik, mPACPL1, ACPL1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66659
Homologene: 41128
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Coq7
Name: demethyl-Q 7
Synonyms: clk-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12850
HGNC: HGNC:2244
Homologene: 6953
Ranbp10
Name: RAN binding protein 10
Synonyms: 4432417N03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74334
Homologene: 49639
Tas1r3
Name: taste receptor, type 1, member 3
Synonyms: T1r3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 83771
Homologene: 12890
Epha5
Name: Eph receptor A5
Synonyms: Cek7, bsk, Els1, Rek7, Hek7, Ehk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13839
HGNC: HGNC:3389
Homologene: 55824
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Tnfrsf1b
Name: tumor necrosis factor receptor superfamily, member 1b
Synonyms: CD120b, TNF-R2, p75, p75 TNFR, Tnfr2, TNF-R75, TNF-R-II, TNFR80, TNFBR, TNFRII, TNF-alphaR2, TNFalpha-R2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21938
Homologene: 829
Fbxo30
Name: F-box protein 30
Synonyms: 1700026A16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71865
Homologene: 12959
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Vmn2r10
Name: vomeronasal 2, receptor 10
Synonyms: VR16, V2r16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22307
Homologene: 129606
Wdr41
Name: WD repeat domain 41
Synonyms: MSTP048, B830029I03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218460
Homologene: 23087
Skint6
Name: selection and upkeep of intraepithelial T cells 6
Synonyms: OTTMUSG00000008519
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230622
Homologene: 135888
Ctnnb1
Name: catenin beta 1
Synonyms: beta-catenin, Catnb, beta catenin, catenin (cadherin associated protein), beta 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12387
HGNC: HGNC:2514
Homologene: 1434
Bbof1
Name: basal body orientation factor 1
Synonyms: 2900006K08Rik, Ccdc176
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72873
Homologene: 75215
Rxfp2
Name: relaxin/insulin-like family peptide receptor 2
Synonyms: Great, LGR8, Gpr106
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140498
Homologene: 15402
Sart1
Name: squamous cell carcinoma antigen recognized by T cells 1
Synonyms: U5-110K
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20227
VEGA: 19
Homologene: 133770
Or5m9b
Name: olfactory receptor family 5 subfamily M member 9B
Synonyms: GA_x6K02T2Q125-47549689-47550621, MOR245-25, MOR262-13, Olfr1036
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258245
Sgk2
Name: serum/glucocorticoid regulated kinase 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27219
Homologene: 8446
Vmn2r24
Name: vomeronasal 2, receptor 24
Synonyms: EG243628
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243628
Homologene: 135915
Vmn2r124
Name: vomeronasal 2, receptor 124
Synonyms: Gm7196, Vmn2r-ps113
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 637021
Homologene: 115024
Psg16
Name: pregnancy specific beta-1-glycoprotein 16
Synonyms: bCEA, Cea11
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26436
Qrfpr
Name: pyroglutamylated RFamide peptide receptor
Synonyms: AQ27, Gpr103, Gpr103a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229214
Homologene: 18865
Cldn15
Name: claudin 15
Synonyms: 2210009B08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 60363
HGNC: HGNC:2036
Homologene: 8646
B4galnt4
Name: beta-1,4-N-acetyl-galactosaminyl transferase 4
Synonyms: LOC381951
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330671
Homologene: 27982
4921524L21Rik
Name: RIKEN cDNA 4921524L21 gene
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70901
VEGA: 18
Homologene: 78009
Rasgrf2
Name: RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms: Grf2, 6330417G04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19418
HGNC: HGNC:9876
Homologene: 2169
Or51b6
Name: olfactory receptor family 51 subfamily B member 6
Synonyms: 5'[b]3, MOR1-2, GA_x6K02T2PBJ9-6634906-6633983, Olfr65
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18365
Homologene: 66459
Tmem109
Name: transmembrane protein 109
Synonyms: 1110006I15Rik, mitsugumin23, MG23
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 68539
Homologene: 11458
Slc35b3
Name: solute carrier family 35, member B3
Synonyms: 4921526O06Rik, PAPST2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 108652
VEGA: 13
Homologene: 9313
S100a8
Name: S100 calcium binding protein A8 (calgranulin A)
Synonyms: MRP8, Caga, 60B8Ag, CFAg, CP-10, B8Ag, p8
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20201
Homologene: 2225
Kcnk12
Name: potassium channel, subfamily K, member 12
Synonyms: mntk1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210741
VEGA: 17
HGNC: HGNC:6274
Homologene: 11107
Snx21
Name: sorting nexin family member 21
Synonyms: 5730407K14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 101113
Homologene: 43132
Gja5
Name: gap junction protein, alpha 5
Synonyms: connexin 40, Cx40, Gja-5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14613
HGNC: HGNC:4279
Homologene: 3856
Trav11
Name: T cell receptor alpha variable 11
Synonyms: ENSMUSG00000072509, Gm10908
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100126466
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 71,258,089 bp
  • A to G, chromosome 2 at 40,903,414 bp
  • G to A, chromosome 2 at 76,822,970 bp
  • G to A, chromosome 2 at 86,075,174 bp
  • A to G, chromosome 2 at 163,006,803 bp
  • G to A, chromosome 2 at 164,786,829 bp
  • T to A, chromosome 3 at 36,180,196 bp
  • A to G, chromosome 3 at 87,783,115 bp
  • A to G, chromosome 3 at 90,669,558 bp
  • A to G, chromosome 3 at 97,051,103 bp
  • T to C, chromosome 3 at 97,159,193 bp
  • C to A, chromosome 4 at 8,838,691 bp
  • T to A, chromosome 4 at 40,179,037 bp
  • G to T, chromosome 4 at 112,804,694 bp
  • A to G, chromosome 4 at 143,133,447 bp
  • A to G, chromosome 4 at 145,219,915 bp
  • A to G, chromosome 4 at 155,861,391 bp
  • A to G, chromosome 5 at 48,302,848 bp
  • T to A, chromosome 5 at 84,107,991 bp
  • T to A, chromosome 5 at 108,996,051 bp
  • T to A, chromosome 5 at 113,263,257 bp
  • T to C, chromosome 5 at 136,974,497 bp
  • C to T, chromosome 5 at 150,018,797 bp
  • T to A, chromosome 6 at 38,698,223 bp
  • G to T, chromosome 6 at 117,178,592 bp
  • A to T, chromosome 6 at 123,780,541 bp
  • A to T, chromosome 6 at 132,657,118 bp
  • C to A, chromosome 7 at 17,093,889 bp
  • A to T, chromosome 7 at 56,135,375 bp
  • T to C, chromosome 7 at 103,906,994 bp
  • C to T, chromosome 7 at 118,527,417 bp
  • C to T, chromosome 7 at 141,067,575 bp
  • C to A, chromosome 8 at 105,773,033 bp
  • G to T, chromosome 8 at 107,556,557 bp
  • T to C, chromosome 9 at 45,447,728 bp
  • A to G, chromosome 9 at 120,955,432 bp
  • G to A, chromosome 10 at 11,289,576 bp
  • T to A, chromosome 11 at 6,347,129 bp
  • G to A, chromosome 11 at 69,589,608 bp
  • A to C, chromosome 11 at 88,839,672 bp
  • A to G, chromosome 11 at 97,956,581 bp
  • A to T, chromosome 12 at 84,413,294 bp
  • C to T, chromosome 13 at 38,937,746 bp
  • A to T, chromosome 13 at 51,711,510 bp
  • A to T, chromosome 13 at 77,066,665 bp
  • T to C, chromosome 13 at 91,890,566 bp
  • T to G, chromosome 13 at 95,015,067 bp
  • T to C, chromosome 13 at 102,783,391 bp
  • C to T, chromosome 14 at 53,519,770 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • T to C, chromosome 17 at 18,062,671 bp
  • A to T, chromosome 17 at 65,772,534 bp
  • T to A, chromosome 17 at 67,810,151 bp
  • T to A, chromosome 17 at 87,746,592 bp
  • T to C, chromosome 18 at 6,226,965 bp
  • A to T, chromosome 18 at 6,629,482 bp
  • T to C, chromosome 19 at 5,388,348 bp
  • A to T, chromosome 19 at 10,872,631 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8796 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068637-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.