Strain Name:
C57BL/6J-MtgxR8805Btlr/Mmmh
Stock Number:
068642-MU
Citation ID:
RRID:MMRRC_068642-MU
Other Names:
R8805 (G1)
Major Collection:

Strain Information

Il2
Name: interleukin 2
Synonyms: IL-2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16183
HGNC: HGNC:6001
Homologene: 488
Rc3h1
Name: RING CCCH (C3H) domains 1
Synonyms: roquin, 5730557L09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381305
Homologene: 19036
Rtn4rl2
Name: reticulon 4 receptor-like 2
Synonyms: Ngrh1, Ngrl3, Ngr2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269295
Homologene: 18683
Cacng7
Name: calcium channel, voltage-dependent, gamma subunit 7
Synonyms: TARP gamma 7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81904
Homologene: 12895
Senp2
Name: SUMO/sentrin specific peptidase 2
Synonyms: 2310007L05Rik, 4930538C18Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 75826
VEGA: 16
Homologene: 11005
Cry1
Name: cryptochrome circadian regulator 1
Synonyms: Phll1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12952
VEGA: 10
HGNC: HGNC:2384
Homologene: 7042
Cdc40
Name: cell division cycle 40
Synonyms: 1200003H23Rik, EHB3, PRP17
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71713
VEGA: 10
Homologene: 5716
Tut4
Name: terminal uridylyl transferase 4
Synonyms: 6030404K05Rik, Zcchc11, Tent3a, 9230115F04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230594
Homologene: 35279
Dek
Name: DEK proto-oncogene
Synonyms: 1810019E15Rik, DEK proto-oncogene (DNA binding), D13H6S231E
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110052
HGNC: HGNC:2768
Homologene: 2593
Yipf1
Name: Yip1 domain family, member 1
Synonyms: C030002N13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230584
Homologene: 5898
Mycbp
Name: MYC binding protein
Synonyms: Amy-1, 5730488M09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56309
HGNC: HGNC:7554
Homologene: 49312
Ccser2
Name: coiled-coil serine rich 2
Synonyms: Gcap14, 2900054P12Rik, 1700012P13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72972
Homologene: 10367
Bmp2
Name: bone morphogenetic protein 2
Synonyms: Bmp2a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12156
HGNC: HGNC:1069
Homologene: 926
Zfp981
Name: zinc finger protein 981
Synonyms: Gm13247
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041433
Homologene: 133076
Lpl
Name: lipoprotein lipase
Synonyms: O 1-4-5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16956
HGNC: HGNC:6677
Homologene: 200
Kank4
Name: KN motif and ankyrin repeat domains 4
Synonyms: Ankrd38
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242553
Homologene: 18244
Rab4b
Name: RAB4B, member RAS oncogene family
Synonyms: 1500031G17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19342
HGNC: HGNC:9782
Homologene: 100632
Crnkl1
Name: crooked neck pre-mRNA splicing factor 1
Synonyms: 1200013P10Rik, 5730590A01Rik, crn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66877
Homologene: 6462
Trmt10b
Name: tRNA methyltransferase 10B
Synonyms: 2610042J10Rik, Rg9mtd3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69934
Homologene: 12340
Zfp655
Name: zinc finger protein 655
Synonyms: 2700038I16Rik, 9030409O18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72611
Homologene: 12473
Mgme1
Name: mitochondrial genome maintenance exonuclease 1
Synonyms: 8430406I07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74528
Homologene: 12573
Mnd1
Name: meiotic nuclear divisions 1
Synonyms: 2610034E18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76915
Homologene: 5890
Dgcr8
Name: DGCR8, microprocessor complex subunit
Synonyms: Vo59c07, N41, D16H22S1742E, D16Wis2, D16H22S788E, Gy1, DiGeorge syndrome critical region gene 8
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 94223
HGNC: HGNC:2847
Homologene: 11223
Taf4b
Name: TATA-box binding protein associated factor 4b
Synonyms: 105kDa, Taf2c2, TAFII105, 4932409F03Rik, 2610524B04Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72504
VEGA: 18
Homologene: 28266
Stk38
Name: serine/threonine kinase 38
Synonyms: 5830476G13Rik, Ndr1, 9530097A09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106504
Homologene: 56033
Rfx7
Name: regulatory factor X, 7
Synonyms: Rfxdc2, 9930116O05Rik, D130086K05Rik, 2510005N23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319758
Homologene: 11275
Gpatch8
Name: G patch domain containing 8
Synonyms: Fbm1, ENSMUSG00000075516, 5430405G24Rik, Gpatc8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237943
Homologene: 46117
Tgm3
Name: transglutaminase 3, E polypeptide
Synonyms: TG E, we
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21818
Homologene: 20690
Cfap46
Name: cilia and flagella associated protein 46
Synonyms: Ttc40, 9330101J02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212124
Has3
Name: hyaluronan synthase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 15118
HGNC: HGNC:4820
Homologene: 68461
Ttn
Name: titin
Synonyms: 2310036G12Rik, 2310057K23Rik, D330041I19Rik, mdm, connectin, D830007G01Rik, 1100001C23Rik, shru, 2310074I15Rik, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Msh4
Name: mutS homolog 4
Synonyms: mMsh4, 4930485C04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 55993
HGNC: HGNC:7327
Homologene: 1830
Clcn2
Name: chloride channel, voltage-sensitive 2
Synonyms: ClC-2, Clc2, nmf240
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12724
HGNC: HGNC:2020
Homologene: 3213
Cfap58
Name: cilia and flagella associated protein 58
Synonyms: LOC381229, Ccdc147
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381229
VEGA: 19
Homologene: 77312
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Stxbp5
Name: syntaxin binding protein 5 (tomosyn)
Synonyms: LGL3, 4930565N16Rik, 0710001E20Rik, tomosyn 1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78808
Homologene: 16402
Lipm
Name: lipase, family member M
Synonyms: 4632427C23Rik, Lipl3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 78753
VEGA: 19
Homologene: 28267
Fbxw7
Name: F-box and WD-40 domain protein 7
Synonyms: Fbxo30, AGO, 1110001A17Rik, SEL-10, Cdc4, Fbw7, Fbxw6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 50754
Homologene: 117451
Pcsk6
Name: proprotein convertase subtilisin/kexin type 6
Synonyms: SPC4, b2b2830Clo, PACE4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18553
HGNC: HGNC:8569
Homologene: 20569
Grm5
Name: glutamate receptor, metabotropic 5
Synonyms: Gprc1e, Glu5R, mGluR5, 6430542K11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108071
HGNC: HGNC:4597
Homologene: 37354
Mtus2
Name: microtubule associated tumor suppressor candidate 2
Synonyms: A730013O20Rik, C130038G02Rik, 5730592G18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77521
Homologene: 78141
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: CPSase I, CPS, 4732433M03Rik, D1Ucla3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Dlec1
Name: deleted in lung and esophageal cancer 1
Synonyms: D630005C06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320256
HGNC: HGNC:2899
Homologene: 84733
Vmn1r214
Name: vomeronasal 1 receptor 214
Synonyms: V1rh5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171248
Homologene: 110880
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Actl6b
Name: actin-like 6B
Synonyms: Baf53b, ArpNa, Actl6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83766
HGNC: HGNC:160
Homologene: 81844
Dstyk
Name: dual serine/threonine and tyrosine protein kinase
Synonyms: C430014H23Rik, A930019K20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213452
Homologene: 19711
Cyp46a1
Name: cytochrome P450, family 46, subfamily a, polypeptide 1
Synonyms: cholestrol 24-hydroxylase, Cyp46
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13116
VEGA: 12
HGNC: HGNC:2641
Homologene: 134501
Kcnk4
Name: potassium channel, subfamily K, member 4
Synonyms: TRAAKt
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16528
VEGA: 19
HGNC: HGNC:6279
Homologene: 7391
Krt2
Name: keratin 2
Synonyms: Krt2-17, Krt2e, Krt2-2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16681
HGNC: HGNC:6439
Osm
Name: oncostatin M
Synonyms: OncoM
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18413
HGNC: HGNC:8506
Homologene: 10741
Pde6a
Name: phosphodiesterase 6A, cGMP-specific, rod, alpha
Synonyms: Pdea
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225600
HGNC: HGNC:8785
Homologene: 380
Mrrf
Name: mitochondrial ribosome recycling factor
Synonyms: 2400002D02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67871
HGNC: HGNC:7234
Homologene: 12203
Gm5773
Name: predicted pseudogene 5773
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 436563
Cotl1
Name: coactosin like F-actin binding protein 1
Synonyms: 1810074P22Rik, 2010004C08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72042
Homologene: 10898
Morn5
Name: MORN repeat containing 5
Synonyms: 1700010A17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75495
Homologene: 16510
Idh1
Name: isocitrate dehydrogenase 1 (NADP+), soluble
Synonyms: Id-1, E030024J03Rik, IDPc, Idh-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15926
HGNC: HGNC:5382
Homologene: 21195
4921509C19Rik
Name: RIKEN cDNA 4921509C19 gene
Synonyms: LOC381389
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381393
Homologene: 72396
Prkd1
Name: protein kinase D1
Synonyms: PKD1, Pkcm, Prkcm
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18760
VEGA: 12
HGNC: HGNC:9407
Homologene: 55680
Vmn2r86
Name: vomeronasal 2, receptor 86
Synonyms: EG625109
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625109
Homologene: 129606
Or7e174
Name: olfactory receptor family 7 subfamily E member 174
Synonyms: GA_x6K02T2PVTD-13841888-13842802, Olfr868, MOR145-4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258552
HGNC: HGNC:8396
Homologene: 74168
Tubal3
Name: tubulin, alpha-like 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238463
VEGA: 13
Homologene: 23488
Stard4
Name: StAR related lipid transfer domain containing 4
Synonyms: 9030213J02Rik, 4632419C16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 170459
Homologene: 15874
Slc38a3
Name: solute carrier family 38, member 3
Synonyms: Snat3, D9Ucla2, 0610012J02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76257
Homologene: 4983
Zdhhc2
Name: zinc finger, DHHC domain containing 2
Synonyms: 6430583A19Rik, 5730415P04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70546
Homologene: 81667
Cyp2a5
Name: cytochrome P450, family 2, subfamily a, polypeptide 5
Synonyms: Coh
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13087
Homologene: 85917
Cracd
Name: capping protein inhibiting regulator of actin
Synonyms: C530008M17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320827
Homologene: 136278
Pdzk1
Name: PDZ domain containing 1
Synonyms: 4921513F16Rik, mPDZK1, 1700023D20Rik, Nherf3, 2610507N21Rik, D3Ertd537e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 59020
Homologene: 1964
Star
Name: steroidogenic acute regulatory protein
Synonyms: D8Ertd419e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20845
Homologene: 297
Sprr1b
Name: small proline-rich protein 1B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20754
Homologene: 134537
Tmem158
Name: transmembrane protein 158
Synonyms: 2310037P21Rik, Ris1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72309
VEGA: 9
Homologene: 9141
Gm9611
Name: predicted gene 9611
Type: Gene
Species: Mouse
Chromosome: 14
Sord
Name: sorbitol dehydrogenase
Synonyms: Sdh-1, Sdh1, Sodh-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20322
Homologene: 56080
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 46,234,145 bp
  • CA to CAA, chromosome 1 at 65,165,188 bp
  • G to A, chromosome 1 at 67,176,951 bp
  • T to C, chromosome 1 at 71,605,080 bp
  • T to A, chromosome 1 at 132,434,225 bp
  • T to C, chromosome 1 at 160,967,652 bp
  • A to G, chromosome 2 at 31,425,381 bp
  • A to G, chromosome 2 at 36,079,521 bp
  • G to A, chromosome 2 at 36,147,953 bp
  • A to T, chromosome 2 at 76,889,963 bp
  • C to A, chromosome 2 at 82,983,109 bp
  • T to C, chromosome 2 at 84,872,214 bp
  • G to A, chromosome 2 at 122,264,126 bp
  • T to A, chromosome 2 at 130,047,782 bp
  • T to A, chromosome 2 at 133,561,334 bp
  • A to G, chromosome 2 at 144,272,531 bp
  • T to C, chromosome 2 at 145,931,430 bp
  • A to T, chromosome 2 at 151,471,365 bp
  • T to A, chromosome 3 at 37,123,133 bp
  • T to A, chromosome 3 at 84,088,125 bp
  • T to A, chromosome 3 at 84,954,920 bp
  • GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGAGCCTTGGGATGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA to GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA, chromosome 3 at 92,437,346 bp
  • T to C, chromosome 3 at 93,773,735 bp
  • T to A, chromosome 3 at 96,851,594 bp
  • T to A, chromosome 3 at 153,857,633 bp
  • T to C, chromosome 4 at 45,301,281 bp
  • T to C, chromosome 4 at 98,780,036 bp
  • A to T, chromosome 4 at 107,336,158 bp
  • T to C, chromosome 4 at 108,549,378 bp
  • T to A, chromosome 4 at 123,910,087 bp
  • C to T, chromosome 4 at 146,537,953 bp
  • T to C, chromosome 5 at 76,858,642 bp
  • G to A, chromosome 5 at 137,554,656 bp
  • C to T, chromosome 5 at 145,244,480 bp
  • A to C, chromosome 5 at 148,078,493 bp
  • T to A, chromosome 7 at 3,366,782 bp
  • G to T, chromosome 7 at 26,841,105 bp
  • T to C, chromosome 7 at 27,174,723 bp
  • A to T, chromosome 7 at 45,684,475 bp
  • T to A, chromosome 7 at 65,929,143 bp
  • G to A, chromosome 7 at 87,803,968 bp
  • C to T, chromosome 7 at 139,632,063 bp
  • G to A, chromosome 8 at 25,809,549 bp
  • G to T, chromosome 8 at 40,445,805 bp
  • A to G, chromosome 8 at 68,887,563 bp
  • A to T, chromosome 8 at 106,874,503 bp
  • T to A, chromosome 8 at 119,810,205 bp
  • T to C, chromosome 9 at 20,101,284 bp
  • C to T, chromosome 9 at 72,617,034 bp
  • T to C, chromosome 9 at 107,655,146 bp
  • C to A, chromosome 9 at 119,112,582 bp
  • A to G, chromosome 9 at 123,260,244 bp
  • T to A, chromosome 10 at 9,838,115 bp
  • A to G, chromosome 10 at 40,857,580 bp
  • A to G, chromosome 10 at 85,157,105 bp
  • A to G, chromosome 10 at 130,446,527 bp
  • A to G, chromosome 11 at 4,239,839 bp
  • T to C, chromosome 11 at 102,480,192 bp
  • C to G, chromosome 12 at 50,388,372 bp
  • T to A, chromosome 12 at 50,388,373 bp
  • T to C, chromosome 12 at 108,361,203 bp
  • T to C, chromosome 13 at 3,933,293 bp
  • C to T, chromosome 13 at 23,035,103 bp
  • A to T, chromosome 13 at 47,099,454 bp
  • A to G, chromosome 14 at 36,879,755 bp
  • T to C, chromosome 14 at 42,294,700 bp
  • T to C, chromosome 15 at 101,815,944 bp
  • T to A, chromosome 16 at 18,258,297 bp
  • C to A, chromosome 16 at 20,713,418 bp
  • A to G, chromosome 16 at 22,028,039 bp
  • G to A, chromosome 17 at 9,007,905 bp
  • G to T, chromosome 17 at 29,000,120 bp
  • C to T, chromosome 18 at 14,813,428 bp
  • T to G, chromosome 18 at 33,203,696 bp
  • A to G, chromosome 18 at 61,257,033 bp
  • T to A, chromosome 19 at 6,928,011 bp
  • A to T, chromosome 19 at 34,112,908 bp
  • A to T, chromosome 19 at 47,953,096 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8805 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068642-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.