Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8805Btlr/Mmmh
Stock Number:
068642-MU
Citation ID:
RRID:MMRRC_068642-MU
Other Names:
R8805 (G1)
Major Collection:

Strain Information

Il2
Name: interleukin 2
Synonyms: IL-2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16183
HGNC: HGNC:6001
Homologene: 488
Rc3h1
Name: RING CCCH (C3H) domains 1
Synonyms: roquin, 5730557L09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381305
Homologene: 19036
Rtn4rl2
Name: reticulon 4 receptor-like 2
Synonyms: Ngr2, Ngrh1, Ngrl3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269295
Homologene: 18683
Cacng7
Name: calcium channel, voltage-dependent, gamma subunit 7
Synonyms: TARP gamma 7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81904
Homologene: 12895
Senp2
Name: SUMO/sentrin specific peptidase 2
Synonyms: 4930538C18Rik, 2310007L05Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 75826
VEGA: 16
Homologene: 11005
Cry1
Name: cryptochrome circadian regulator 1
Synonyms: Phll1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12952
VEGA: 10
HGNC: HGNC:2384
Homologene: 7042
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 46,234,145 bp
  • CA to CAA, chromosome 1 at 65,165,188 bp
  • G to A, chromosome 1 at 67,176,951 bp
  • T to C, chromosome 1 at 71,605,080 bp
  • T to A, chromosome 1 at 132,434,225 bp
  • T to C, chromosome 1 at 160,967,652 bp
  • A to G, chromosome 2 at 31,425,381 bp
  • A to G, chromosome 2 at 36,079,521 bp
  • G to A, chromosome 2 at 36,147,953 bp
  • A to T, chromosome 2 at 76,889,963 bp
  • C to A, chromosome 2 at 82,983,109 bp
  • T to C, chromosome 2 at 84,872,214 bp
  • G to A, chromosome 2 at 122,264,126 bp
  • T to A, chromosome 2 at 130,047,782 bp
  • T to A, chromosome 2 at 133,561,334 bp
  • A to G, chromosome 2 at 144,272,531 bp
  • T to C, chromosome 2 at 145,931,430 bp
  • A to T, chromosome 2 at 151,471,365 bp
  • T to A, chromosome 3 at 37,123,133 bp
  • T to A, chromosome 3 at 84,088,125 bp
  • T to A, chromosome 3 at 84,954,920 bp
  • GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGAGCCTTGGGATGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA to GTGGCAGGGCTCAGGAGCCTTGGGGTGGCAGGGCTCAGGA, chromosome 3 at 92,437,346 bp
  • T to C, chromosome 3 at 93,773,735 bp
  • T to A, chromosome 3 at 96,851,594 bp
  • T to A, chromosome 3 at 153,857,633 bp
  • T to C, chromosome 4 at 45,301,281 bp
  • T to C, chromosome 4 at 98,780,036 bp
  • A to T, chromosome 4 at 107,336,158 bp
  • T to C, chromosome 4 at 108,549,378 bp
  • T to A, chromosome 4 at 123,910,087 bp
  • C to T, chromosome 4 at 146,537,953 bp
  • T to C, chromosome 5 at 76,858,642 bp
  • G to A, chromosome 5 at 137,554,656 bp
  • C to T, chromosome 5 at 145,244,480 bp
  • A to C, chromosome 5 at 148,078,493 bp
  • T to A, chromosome 7 at 3,366,782 bp
  • G to T, chromosome 7 at 26,841,105 bp
  • T to C, chromosome 7 at 27,174,723 bp
  • A to T, chromosome 7 at 45,684,475 bp
  • T to A, chromosome 7 at 65,929,143 bp
  • G to A, chromosome 7 at 87,803,968 bp
  • C to T, chromosome 7 at 139,632,063 bp
  • G to A, chromosome 8 at 25,809,549 bp
  • G to T, chromosome 8 at 40,445,805 bp
  • A to G, chromosome 8 at 68,887,563 bp
  • A to T, chromosome 8 at 106,874,503 bp
  • T to A, chromosome 8 at 119,810,205 bp
  • T to C, chromosome 9 at 20,101,284 bp
  • C to T, chromosome 9 at 72,617,034 bp
  • T to C, chromosome 9 at 107,655,146 bp
  • C to A, chromosome 9 at 119,112,582 bp
  • A to G, chromosome 9 at 123,260,244 bp
  • T to A, chromosome 10 at 9,838,115 bp
  • A to G, chromosome 10 at 40,857,580 bp
  • A to G, chromosome 10 at 85,157,105 bp
  • A to G, chromosome 10 at 130,446,527 bp
  • A to G, chromosome 11 at 4,239,839 bp
  • T to C, chromosome 11 at 102,480,192 bp
  • C to G, chromosome 12 at 50,388,372 bp
  • T to A, chromosome 12 at 50,388,373 bp
  • T to C, chromosome 12 at 108,361,203 bp
  • T to C, chromosome 13 at 3,933,293 bp
  • C to T, chromosome 13 at 23,035,103 bp
  • A to T, chromosome 13 at 47,099,454 bp
  • A to G, chromosome 14 at 36,879,755 bp
  • T to C, chromosome 14 at 42,294,700 bp
  • T to C, chromosome 15 at 101,815,944 bp
  • T to A, chromosome 16 at 18,258,297 bp
  • C to A, chromosome 16 at 20,713,418 bp
  • A to G, chromosome 16 at 22,028,039 bp
  • G to A, chromosome 17 at 9,007,905 bp
  • G to T, chromosome 17 at 29,000,120 bp
  • C to T, chromosome 18 at 14,813,428 bp
  • T to G, chromosome 18 at 33,203,696 bp
  • A to G, chromosome 18 at 61,257,033 bp
  • T to A, chromosome 19 at 6,928,011 bp
  • A to T, chromosome 19 at 34,112,908 bp
  • A to T, chromosome 19 at 47,953,096 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8805 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068642-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.