Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8807Btlr/Mmmh
Stock Number:
068643-MU
Citation ID:
RRID:MMRRC_068643-MU
Other Names:
R8807 (G1)
Major Collection:

Strain Information

Hfe
Name: homeostatic iron regulator
Synonyms: MR2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15216
HGNC: HGNC:4886
Homologene: 88330
Cdc25a
Name: cell division cycle 25A
Synonyms: D9Ertd393e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12530
HGNC: HGNC:1725
Homologene: 1355
En1
Name: engrailed 1
Synonyms: Mo-en.1, En-1, engrailed-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13798
HGNC: HGNC:3342
Homologene: 50663
Gaa
Name: glucosidase, alpha, acid
Synonyms: E430018M07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14387
HGNC: HGNC:4065
Homologene: 37268
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: B930007L02Rik, Vprbp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 321006
Homologene: 8805
Vps13c
Name: vacuolar protein sorting 13C
Synonyms: C230055H22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320528
VEGA: 9
Homologene: 41188
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 24,731,762 bp
  • T to C, chromosome 1 at 52,658,547 bp
  • T to C, chromosome 1 at 120,603,361 bp
  • T to A, chromosome 1 at 171,383,714 bp
  • G to A, chromosome 1 at 173,526,567 bp
  • A to G, chromosome 2 at 24,974,866 bp
  • A to T, chromosome 2 at 34,838,806 bp
  • A to T, chromosome 2 at 74,705,969 bp
  • G to A, chromosome 2 at 76,752,065 bp
  • A to T, chromosome 2 at 85,992,828 bp
  • T to A, chromosome 2 at 120,705,451 bp
  • A to C, chromosome 2 at 120,705,462 bp
  • T to G, chromosome 2 at 131,145,183 bp
  • T to C, chromosome 3 at 86,085,352 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • T to G, chromosome 3 at 108,960,336 bp
  • A to G, chromosome 4 at 59,517,584 bp
  • A to G, chromosome 4 at 88,754,976 bp
  • A to T, chromosome 4 at 117,926,718 bp
  • C to T, chromosome 5 at 9,511,499 bp
  • T to A, chromosome 5 at 16,267,454 bp
  • T to C, chromosome 5 at 48,377,152 bp
  • C to T, chromosome 5 at 66,676,258 bp
  • G to A, chromosome 5 at 142,085,627 bp
  • T to C, chromosome 6 at 35,183,969 bp
  • T to C, chromosome 6 at 48,988,254 bp
  • A to T, chromosome 6 at 90,351,128 bp
  • A to C, chromosome 6 at 121,874,475 bp
  • C to T, chromosome 7 at 25,211,280 bp
  • A to T, chromosome 7 at 45,999,007 bp
  • T to A, chromosome 7 at 66,079,719 bp
  • G to C, chromosome 7 at 89,147,978 bp
  • A to T, chromosome 7 at 108,172,645 bp
  • A to T, chromosome 7 at 120,891,707 bp
  • A to T, chromosome 7 at 131,244,778 bp
  • A to T, chromosome 8 at 46,020,695 bp
  • C to A, chromosome 8 at 68,892,628 bp
  • C to T, chromosome 8 at 72,750,080 bp
  • A to G, chromosome 8 at 104,469,109 bp
  • C to T, chromosome 8 at 117,411,355 bp
  • T to A, chromosome 9 at 18,656,057 bp
  • TCGCC to TC, chromosome 9 at 21,944,431 bp
  • G to T, chromosome 9 at 67,858,840 bp
  • G to A, chromosome 9 at 80,300,667 bp
  • A to G, chromosome 9 at 106,865,069 bp
  • G to A, chromosome 9 at 109,879,235 bp
  • G to T, chromosome 9 at 110,629,639 bp
  • A to T, chromosome 9 at 114,330,180 bp
  • C to A, chromosome 11 at 59,079,644 bp
  • A to T, chromosome 11 at 67,220,528 bp
  • T to C, chromosome 11 at 87,796,339 bp
  • T to A, chromosome 11 at 106,544,368 bp
  • T to C, chromosome 11 at 106,567,588 bp
  • C to G, chromosome 11 at 107,603,009 bp
  • A to T, chromosome 11 at 110,083,426 bp
  • A to T, chromosome 11 at 115,393,915 bp
  • T to A, chromosome 11 at 116,221,027 bp
  • A to T, chromosome 11 at 119,277,567 bp
  • C to T, chromosome 12 at 28,565,490 bp
  • T to A, chromosome 12 at 113,661,784 bp
  • A to G, chromosome 13 at 23,535,458 bp
  • C to T, chromosome 13 at 23,705,684 bp
  • A to T, chromosome 13 at 47,014,514 bp
  • A to G, chromosome 14 at 55,745,042 bp
  • A to G, chromosome 14 at 61,232,481 bp
  • T to A, chromosome 14 at 110,750,691 bp
  • G to A, chromosome 15 at 32,562,722 bp
  • A to T, chromosome 15 at 44,197,816 bp
  • A to G, chromosome 15 at 75,566,207 bp
  • T to A, chromosome 15 at 98,792,764 bp
  • T to A, chromosome 16 at 93,762,085 bp
  • T to A, chromosome 16 at 96,178,608 bp
  • C to T, chromosome 17 at 24,695,872 bp
  • T to A, chromosome 17 at 31,265,854 bp
  • C to T, chromosome 17 at 33,575,905 bp
  • T to C, chromosome 17 at 69,487,345 bp
  • C to T, chromosome 18 at 77,356,772 bp
  • C to T, chromosome 19 at 4,163,230 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8807 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068643-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.