Strain Name:
C57BL/6J-MtgxR8808Btlr/Mmmh
Stock Number:
068644-MU
Citation ID:
RRID:MMRRC_068644-MU
Other Names:
R8808 (G1)
Major Collection:

Strain Information

Itga8
Name: integrin alpha 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
Chrna5
Name: cholinergic receptor, nicotinic, alpha polypeptide 5
Synonyms: Acra5, Acra-5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110835
VEGA: 9
HGNC: HGNC:1959
Homologene: 55485
Dap3
Name: death associated protein 3
Synonyms: DAP-3, 4921514D13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 65111
HGNC: HGNC:2673
Homologene: 3404
Agt
Name: angiotensinogen
Synonyms: Serpina8, Aogen, angiotensin precursor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11606
HGNC: HGNC:333
Homologene: 14
Prep
Name: prolyl endopeptidase
Synonyms: Pop, prolyl oligopeptidase, D10Wsu136e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19072
VEGA: 10
HGNC: HGNC:9358
Homologene: 2042
Zfp407
Name: zinc finger protein 407
Synonyms: 6430585N13Rik, LOC381139, LOC240469
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240476
Homologene: 86402
Hk2
Name: hexokinase 2
Synonyms: HKII
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15277
HGNC: HGNC:4923
Homologene: 37273
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, enaptin165, SYNE-1, C130039F11Rik, A330049M09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Tmem135
Name: transmembrane protein 135
Synonyms: 2810439K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72759
Homologene: 11295
Vps50
Name: VPS50 EARP/GARPII complex subunit
Synonyms: Ccdc132, 8430415E05Rik, 1700034M03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73288
Homologene: 11498
Eif2ak1
Name: eukaryotic translation initiation factor 2 alpha kinase 1
Synonyms: Hri
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15467
Homologene: 8290
Jak3
Name: Janus kinase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16453
HGNC: HGNC:6193
Homologene: 181
Htt
Name: huntingtin
Synonyms: C430023I11Rik, Hdh, htt, huntingtin, HD, IT15
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Yy1
Name: YY1 transcription factor
Synonyms: UCRBP transcription factor, Yin Yang 1, NF-E1, delta transcription factor
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22632
Homologene: 2556
Tmem201
Name: transmembrane protein 201
Synonyms: D4Ertd429e, Samp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230917
Homologene: 35319
Zfp949
Name: zinc finger protein 949
Synonyms: 4930422I07Rik, Nczf
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71640
Homologene: 129930
Plekhm3
Name: pleckstrin homology domain containing, family M, member 3
Synonyms: Plekhm1l, 9430067K14Rik, A230102O09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241075
Homologene: 18459
Heatr5b
Name: HEAT repeat containing 5B
Synonyms: D330050P16Rik, A230048G03Rik, 2010013B10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320473
VEGA: 17
Homologene: 25536
Kdm4a
Name: lysine (K)-specific demethylase 4A
Synonyms: Jmjd2a, JHDM3A, D4Ertd222e, Jmjd2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230674
Homologene: 27780
Prap1
Name: proline-rich acidic protein 1
Synonyms: Upa
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22264
Homologene: 130637
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: Dnahc1, B230373P09Rik, G1-415-19, ferf1, MDHC7, E030034C22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Pitpnm1
Name: phosphatidylinositol transfer protein, membrane-associated 1
Synonyms: RdgB, DRES9
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18739
HGNC: HGNC:9003
Homologene: 3608
Ethe1
Name: ethylmalonic encephalopathy 1
Synonyms: 0610025L15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66071
Homologene: 8622
Ttn
Name: titin
Synonyms: connectin, 1100001C23Rik, D330041I19Rik, D830007G01Rik, 2310074I15Rik, 2310036G12Rik, mdm, 2310057K23Rik, shru, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Tpgs2
Name: tubulin polyglutamylase complex subunit 2
Synonyms: 5730437P09Rik, 5730494M16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66648
Homologene: 9161
Aqp8
Name: aquaporin 8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11833
HGNC: HGNC:642
Homologene: 68166
1110002E22Rik
Name: RIKEN cDNA 1110002E22 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 102634333
Homologene: 131709
Or8k33
Name: olfactory receptor family 8 subfamily K member 33
Synonyms: MOR192-1, GA_x6K02T2Q125-48039418-48038477, Olfr1080
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258404
Homologene: 104285
Arhgef11
Name: Rho guanine nucleotide exchange factor 11
Synonyms: Prg, PDZ-RhoGEF
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213498
Homologene: 11409
Mrpl4
Name: mitochondrial ribosomal protein L4
Synonyms: 1110017G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66163
VEGA: 9
Homologene: 32286
Or4k36
Name: olfactory receptor family 4 subfamily K member 36
Synonyms: Olfr1280, MOR248-1, GA_x6K02T2Q125-72366920-72367837
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258910
Homologene: 121540
St18
Name: suppression of tumorigenicity 18
Synonyms: Myt3, Nzf3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240690
Homologene: 8792
Disp2
Name: dispatched RND transporter family member 2
Synonyms: B230210L08Rik, DispB
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214240
Homologene: 24916
Map3k19
Name: mitogen-activated protein kinase kinase kinase 19
Synonyms: Ysk4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22625
Homologene: 19318
Als2cl
Name: ALS2 C-terminal like
Synonyms: mRn.49018, D930044G19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235633
Homologene: 17152
Mpeg1
Name: macrophage expressed gene 1
Synonyms: MPS1, Perforin-2, Mpg-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17476
VEGA: 19
Homologene: 11216
Nme8
Name: NME/NM23 family member 8
Synonyms: Sptrx-2, Txndc3, 1700056P15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73412
Homologene: 9593
Fam186a
Name: family with sequence similarity 186, member A
Synonyms: LOC380973, 1700030F18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72277
Zfp616
Name: zinc finger protein 616
Synonyms: Gm12330
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327963
Homologene: 88945
Adra1d
Name: adrenergic receptor, alpha 1d
Synonyms: Adra-1, Adra1a, Gpcr8, alpha1D-AR, Adra1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11550
HGNC: HGNC:280
Homologene: 551
Rnf19a
Name: ring finger protein 19A
Synonyms: XYbp, Dorfin, XY body protein, Rnf19
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 30945
VEGA: 15
Homologene: 8501
Cc2d1a
Name: coiled-coil and C2 domain containing 1A
Synonyms: Freud-1, Tape
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212139
Homologene: 23040
Zswim5
Name: zinc finger SWIM-type containing 5
Synonyms: 4933426E21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74464
Homologene: 18958
Actl10
Name: actin-like 10
Synonyms: 1700007I08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70362
Homologene: 128516
Gbp9
Name: guanylate-binding protein 9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 236573
Homologene: 128731
Spata31f3
Name: spermatogenesis associated 31 subfamily F member 3
Synonyms: BC049635, Fam205c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277773
Homologene: 77625
4933412E24Rik
Name: RIKEN cDNA 4933412E24 gene
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71088
VEGA: 15
Homologene: 129990
Rergl
Name: RERG/RAS-like
Synonyms: EG632971
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 632971
Homologene: 41583
Tmcc1
Name: transmembrane and coiled coil domains 1
Synonyms: 3632431M01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330401
Homologene: 8995
Cd300ld2
Name: CD300 molecule like family member D2
Synonyms: Gm11709
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 629970
Tssc4
Name: tumor-suppressing subchromosomal transferable fragment 4
Synonyms: ESTM671070
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56844
Homologene: 4169
Plppr2
Name: phospholipid phosphatase related 2
Synonyms: PRG-4, BC018242, Lppr2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235044
Homologene: 11229
Il9
Name: interleukin 9
Synonyms: P40, Il-9
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16198
VEGA: 13
HGNC: HGNC:6029
Homologene: 492
Ankrd63
Name: ankyrin repeat domain 63
Synonyms: Gm1337, LOC383787
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 383787
Homologene: 19774
Tmem71
Name: transmembrane protein 71
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213068
VEGA: 15
Homologene: 51638
Cct8l1
Name: chaperonin containing TCP1 subunit 8-like 1
Synonyms: LOC242891, Gm443
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242891
Homologene: 40943
Cacng4
Name: calcium channel, voltage-dependent, gamma subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54377
HGNC: HGNC:1408
Homologene: 8674
Kcnmb2
Name: potassium large conductance calcium-activated channel, subfamily M, beta member 2
Synonyms: 2700049B16Rik, 3110031N04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72413
HGNC: HGNC:6286
Homologene: 4257
Klhl38
Name: kelch-like 38
Synonyms: 8230402K04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268807
Homologene: 18622
Pcdhgb6
Name: protocadherin gamma subfamily B, 6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93703
HGNC: HGNC:8713
Homologene: 49573
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 6,810,602 bp
  • G to A, chromosome 1 at 64,883,196 bp
  • A to G, chromosome 1 at 127,824,129 bp
  • T to A, chromosome 1 at 150,655,819 bp
  • A to T, chromosome 2 at 12,132,517 bp
  • T to A, chromosome 2 at 76,867,195 bp
  • T to A, chromosome 2 at 76,892,784 bp
  • G to A, chromosome 2 at 86,553,953 bp
  • A to T, chromosome 2 at 111,315,894 bp
  • G to T, chromosome 2 at 118,703,068 bp
  • A to G, chromosome 2 at 118,790,008 bp
  • T to C, chromosome 2 at 131,561,477 bp
  • T to A, chromosome 2 at 154,553,148 bp
  • A to C, chromosome 3 at 32,198,117 bp
  • A to G, chromosome 3 at 87,686,029 bp
  • A to T, chromosome 3 at 88,928,207 bp
  • C to T, chromosome 3 at 138,070,113 bp
  • TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG to TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG, chromosome 4 at 42,871,823 bp
  • T to A, chromosome 4 at 116,965,690 bp
  • C to T, chromosome 4 at 118,142,283 bp
  • C to A, chromosome 4 at 149,729,681 bp
  • T to A, chromosome 5 at 25,517,212 bp
  • T to A, chromosome 5 at 34,889,447 bp
  • A to G, chromosome 5 at 105,085,009 bp
  • A to T, chromosome 5 at 143,879,446 bp
  • G to T, chromosome 6 at 3,522,338 bp
  • T to A, chromosome 6 at 82,728,766 bp
  • C to G, chromosome 6 at 84,019,484 bp
  • A to T, chromosome 6 at 116,134,137 bp
  • C to A, chromosome 6 at 116,134,138 bp
  • T to G, chromosome 6 at 139,501,867 bp
  • T to C, chromosome 7 at 24,595,071 bp
  • G to C, chromosome 7 at 89,147,978 bp
  • T to C, chromosome 7 at 123,466,699 bp
  • C to A, chromosome 7 at 140,097,069 bp
  • T to C, chromosome 7 at 143,069,699 bp
  • A to G, chromosome 8 at 71,685,520 bp
  • T to C, chromosome 8 at 84,134,970 bp
  • T to A, chromosome 8 at 124,564,289 bp
  • T to A, chromosome 9 at 21,007,682 bp
  • TCGCC to TC, chromosome 9 at 21,944,431 bp
  • T to A, chromosome 9 at 54,998,064 bp
  • G to A, chromosome 9 at 88,569,364 bp
  • G to T, chromosome 9 at 110,889,214 bp
  • T to A, chromosome 10 at 5,359,074 bp
  • T to A, chromosome 10 at 45,095,156 bp
  • T to G, chromosome 11 at 74,085,697 bp
  • T to A, chromosome 11 at 107,794,383 bp
  • CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG to CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG, chromosome 11 at 115,012,431 bp
  • CGGCGACCACGGCGGCGGCGGGGGCG to CGGCG, chromosome 12 at 108,793,580 bp
  • A to G, chromosome 13 at 19,675,808 bp
  • C to A, chromosome 13 at 56,482,129 bp
  • A to G, chromosome 14 at 31,286,814 bp
  • A to T, chromosome 15 at 36,241,875 bp
  • A to T, chromosome 15 at 58,314,829 bp
  • T to C, chromosome 15 at 60,016,070 bp
  • G to A, chromosome 15 at 66,538,806 bp
  • G to C, chromosome 15 at 99,944,723 bp
  • G to A, chromosome 17 at 78,765,405 bp
  • A to G, chromosome 18 at 25,151,218 bp
  • A to G, chromosome 18 at 37,743,398 bp
  • T to C, chromosome 18 at 84,343,060 bp
  • T to A, chromosome 19 at 4,112,356 bp
  • T to A, chromosome 19 at 12,463,079 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8808 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068644-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.