Strain Name:
C57BL/6J-MtgxR8815Btlr/Mmmh
Stock Number:
068650-MU
Citation ID:
RRID:MMRRC_068650-MU
Other Names:
R8815 (G1)
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: neuroaxonal dystrophy, ROSA62, SpbIV, nmf261, 1700022P15Rik, Spnb4, dyn, 5830426A08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Pias3
Name: protein inhibitor of activated STAT 3
Synonyms: Pias3L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229615
Homologene: 4447
Spns1
Name: SPNS lysolipid transporter 1, lysophospholipid
Synonyms: 2210013K02Rik, spinster homolog
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73658
Homologene: 41530
Ip6k1
Name: inositol hexaphosphate kinase 1
Synonyms: InsP6, 1200016D08Rik, InsP6k1, Ihpk1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27399
Homologene: 56602
Ptprf
Name: protein tyrosine phosphatase receptor type F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Tanc1
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms: 1200003E16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66860
Homologene: 18946
Pepd
Name: peptidase D
Synonyms: peptidase D, Pep-4, Pep4, dal
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18624
HGNC: HGNC:8840
Homologene: 239
Dip2c
Name: disco interacting protein 2 homolog C
Synonyms: 2900024P20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 208440
Homologene: 40996
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Mhdadsk9, Dsk9, Nf-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Helb
Name: helicase (DNA) B
Synonyms: D10Ertd664e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 117599
Homologene: 50463
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Fbxo38
Name: F-box protein 38
Synonyms: 6030410I24Rik, SP329
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 107035
VEGA: 18
Homologene: 34526
Naf1
Name: nuclear assembly factor 1 ribonucleoprotein
Synonyms: LOC234344
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234344
Homologene: 128518
Cklf
Name: chemokine-like factor
Synonyms: CKLF3, chemokine-like factor 4, CKLF5, Cklf6, 1700001C14Rik, C32, CKLF1, CKLF2, A730028G07Rik, CKLF4, UCK-1, HSPC224
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75458
Homologene: 9663
Smc5
Name: structural maintenance of chromosomes 5
Synonyms: Smc5l1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226026
VEGA: 19
Homologene: 41009
Icam1
Name: intercellular adhesion molecule 1
Synonyms: MALA-2, Icam-1, Ly-47, CD54
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15894
VEGA: 9
HGNC: HGNC:5344
Homologene: 168
Lrrn2
Name: leucine rich repeat protein 2, neuronal
Synonyms: 5730406J09Rik, NLRR-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16980
Homologene: 21274
Haus8
Name: 4HAUS augmin-like complex, subunit 8
Synonyms: Hice1, 2410004L22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76478
Homologene: 12644
Brip1
Name: BRCA1 interacting protein C-terminal helicase 1
Synonyms: BACH1, 3110009N10Rik, 8030460J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237911
Homologene: 32766
Prss22
Name: serine protease 22
Synonyms: BSSP-4, 4733401N09Rik, SP001LA
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70835
VEGA: 17
Homologene: 23344
Sbsn
Name: suprabasin
Synonyms: 1110005D19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 282619
Homologene: 17900
Sdc3
Name: syndecan 3
Synonyms: syn-3, Synd3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20970
Homologene: 7965
Galnt12
Name: polypeptide N-acetylgalactosaminyltransferase 12
Synonyms: A630062B03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230145
Homologene: 11637
Srcap
Name: Snf2-related CREBBP activator protein
Synonyms: D030022P06Rik, F630004O05Rik, B930091H02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043597
Homologene: 38213
Trpc7
Name: transient receptor potential cation channel, subfamily C, member 7
Synonyms: TRP7, Trrp8
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26946
Homologene: 22689
Atf3
Name: activating transcription factor 3
Synonyms: LRG-21
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11910
HGNC: HGNC:785
Homologene: 1265
Ppm1m
Name: protein phosphatase 1M
Synonyms: PP2C eta, 2810423O19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67905
Homologene: 44900
Ttn
Name: titin
Synonyms: connectin, shru, D330041I19Rik, 2310057K23Rik, mdm, D830007G01Rik, 2310074I15Rik, 1100001C23Rik, 2310036G12Rik, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Kif27
Name: kinesin family member 27
Synonyms: 4930517I18Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75050
VEGA: 13
Homologene: 69235
Pcdhb4
Name: protocadherin beta 4
Synonyms: PcdhbD, Pcdhb5A
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93875
HGNC: HGNC:8690
Homologene: 62176
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Astn2
Name: astrotactin 2
Synonyms: 1d8, Astnl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56079
Homologene: 77850
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Slx4
Name: SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
Synonyms: D16Bwg1016e, Btbd12
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 52864
Homologene: 23770
Ankrd61
Name: ankyrin repeat domain 61
Synonyms: 4921520G13Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66729
Homologene: 87028
Gprc6a
Name: G protein-coupled receptor, family C, group 6, member A
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 210198
VEGA: 10
Homologene: 17529
Atp10b
Name: ATPase, class V, type 10B
Synonyms: 9030605H24Rik, 5930426O13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319767
Homologene: 70969
Fbxw14
Name: F-box and WD-40 domain protein 14
Synonyms: E330009N23Rik, Fbx12, Fbxo12
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50757
Homologene: 110776
Pappa
Name: pregnancy-associated plasma protein A
Synonyms: 8430414N03Rik, IGFBP-4ase, PAPP-A, PAG1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18491
HGNC: HGNC:8602
Homologene: 31097
Ccdc27
Name: coiled-coil domain containing 27
Synonyms: LOC381580
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381580
Homologene: 17596
Acad9
Name: acyl-Coenzyme A dehydrogenase family, member 9
Synonyms: C630012L17Rik, 2600017P15Rik, NPD002
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229211
Homologene: 8539
Myo1a
Name: myosin IA
Synonyms: brush border myosin 1, Myhl, BBM-I
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432516
VEGA: 10
HGNC: HGNC:7595
Homologene: 21113
Fes
Name: feline sarcoma oncogene
Synonyms: c-fes
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14159
HGNC: HGNC:3657
Homologene: 37563
Lrit2
Name: leucine-rich repeat, immunoglobulin-like and transmembrane domains 2
Synonyms: A930010E21Rik, Lrrc22
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239038
VEGA: 14
Homologene: 18292
Them4
Name: thioesterase superfamily member 4
Synonyms: 4921507I02Rik, 2700077M13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75778
Homologene: 14208
Or52a5
Name: olfactory receptor family 52 subfamily A member 5
Synonyms: GA_x6K02T2PBJ9-6504436-6503489, 3'[b]2, Olfr68, MOR22-3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18369
Homologene: 130658
Srsf12
Name: serine and arginine-rich splicing factor 12
Synonyms: Sfrs13b, Srrp
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 272009
Ankfn1
Name: ankyrin-repeat and fibronectin type III domain containing 1
Synonyms: nmf9, LOC382543, mWAKE, 4932411E22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 382543
Homologene: 34996
Vwa5b2
Name: von Willebrand factor A domain containing 5B2
Synonyms: EG328644
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 328643
Homologene: 28056
Ano5
Name: anoctamin 5
Synonyms: Tmem16e, Gdd1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233246
Homologene: 100071
Arhgap31
Name: Rho GTPase activating protein 31
Synonyms: CdGAP
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12549
Homologene: 10644
Ripply3
Name: ripply transcriptional repressor 3
Synonyms: Dscr6
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 170765
HGNC: HGNC:3047
Homologene: 10350
Gm14226
Name: predicted gene 14226
Type: Gene
Species: Mouse
Chromosome: 2
Itga2b
Name: integrin alpha 2b
Synonyms: platelet glycoprotein IIb, CD41, GP IIb, alphaIIb, GpIIb
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16399
HGNC: HGNC:6138
Homologene: 37304
A430078G23Rik
Name: RIKEN cDNA A430078G23 gene
Type: Gene
Species: Mouse
Chromosome: 8
Ceacam5
Name: CEA cell adhesion molecule 5
Synonyms: Psg30, 1600029H12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73250
HGNC: HGNC:1819
Homologene: 115938
Or9r3
Name: olfactory receptor family 9 subfamily R member 3
Synonyms: MOR210-4, GA_x6K02T2PULF-11783479-11782532, Olfr823
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258668
Homologene: 45026
Pp2d1
Name: protein phosphatase 2C-like domain containing 1
Synonyms: 4921523A10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 110332
VEGA: 17
Homologene: 16981
Mettl22
Name: methyltransferase 22, Kin17 lysine
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239706
Homologene: 16619
Mfhas1
Name: malignant fibrous histiocytoma amplified sequence 1
Synonyms: 2310066G09Rik, D8Ertd91e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52065
Homologene: 3114
Lrrc32
Name: leucine rich repeat containing 32
Synonyms: D7H11S833E, Garp, D11S833Eh, EG434215
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434215
HGNC: HGNC:4161
Homologene: 4027
Lpcat2
Name: lysophosphatidylcholine acyltransferase 2
Synonyms: lysoPAFAT/LPCAT2, Aytl1, LPCAT2, Aytl1a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270084
Homologene: 41201
Cpeb4
Name: cytoplasmic polyadenylation element binding protein 4
Synonyms: 4930447D24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67579
Homologene: 12736
Or5ac16
Name: olfactory receptor family 5 subfamily AC member 16
Synonyms: Olfr198, MOR182-8, GA_x54KRFPKG5P-55416332-55415412
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258036
Homologene: 51800
Rrm2
Name: ribonucleotide reductase M2
Synonyms: R2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20135
Homologene: 20277
1700066M21Rik
Name: RIKEN cDNA 1700066M21 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73467
Homologene: 13624
Mitd1
Name: MIT, microtubule interacting and transport, domain containing 1
Synonyms: 1500032H18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69028
Homologene: 14787
Or12k7
Name: olfactory receptor family 12 subfamily K member 7
Synonyms: Olfr360, MOR159-1, GA_x6K02T2NLDC-33760081-33761034
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258615
Homologene: 73997
Apela
Name: apelin receptor early endogenous ligand
Synonyms: Ende, Ela, Elabela, Gm10664
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100038489
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Speer4a3
Name: spermatogenesis associated glutamate (E)-rich protein 4A3
Synonyms: Gm21671
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100862359
Homologene: 69402
Eef1akmt4
Name: EEF1A lysine methyltransferase 4
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 110599566
VEGA: 16
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 37,890,234 bp
  • A to T, chromosome 1 at 57,382,784 bp
  • T to A, chromosome 1 at 132,939,093 bp
  • G to T, chromosome 1 at 191,177,367 bp
  • G to T, chromosome 2 at 37,068,417 bp
  • A to T, chromosome 2 at 40,665,159 bp
  • A to G, chromosome 2 at 59,790,841 bp
  • C to T, chromosome 2 at 76,798,020 bp
  • A to T, chromosome 2 at 76,867,900 bp
  • G to A, chromosome 2 at 155,024,618 bp
  • T to C, chromosome 3 at 36,085,441 bp
  • C to T, chromosome 3 at 94,324,303 bp
  • T to C, chromosome 3 at 96,700,065 bp
  • T to C, chromosome 4 at 33,226,045 bp
  • A to G, chromosome 4 at 47,113,908 bp
  • A to G, chromosome 4 at 65,181,110 bp
  • A to T, chromosome 4 at 65,912,597 bp
  • C to A, chromosome 4 at 118,237,928 bp
  • T to A, chromosome 4 at 130,819,025 bp
  • T to A, chromosome 4 at 154,026,748 bp
  • A to G, chromosome 5 at 25,953,193 bp
  • A to G, chromosome 5 at 143,894,518 bp
  • G to T, chromosome 5 at 150,394,138 bp
  • T to A, chromosome 7 at 17,759,360 bp
  • G to A, chromosome 7 at 27,407,232 bp
  • T to A, chromosome 7 at 30,754,802 bp
  • A to G, chromosome 7 at 34,971,691 bp
  • C to T, chromosome 7 at 51,544,800 bp
  • A to G, chromosome 7 at 80,383,871 bp
  • T to A, chromosome 7 at 98,499,035 bp
  • T to C, chromosome 7 at 103,418,317 bp
  • A to G, chromosome 7 at 103,777,856 bp
  • G to A, chromosome 7 at 126,372,421 bp
  • G to C, chromosome 7 at 127,558,865 bp
  • GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG to GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,240,434 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • C to A, chromosome 8 at 3,380,410 bp
  • T to A, chromosome 8 at 35,590,240 bp
  • A to T, chromosome 8 at 65,036,938 bp
  • A to G, chromosome 8 at 66,864,681 bp
  • A to T, chromosome 8 at 71,253,266 bp
  • A to G, chromosome 8 at 92,914,351 bp
  • C to T, chromosome 8 at 104,250,928 bp
  • A to T, chromosome 9 at 21,026,566 bp
  • G to A, chromosome 9 at 106,199,038 bp
  • A to G, chromosome 9 at 108,041,012 bp
  • G to A, chromosome 9 at 109,276,237 bp
  • A to G, chromosome 10 at 51,620,983 bp
  • A to T, chromosome 10 at 120,112,787 bp
  • C to T, chromosome 10 at 127,710,174 bp
  • T to A, chromosome 10 at 130,111,939 bp
  • G to A, chromosome 11 at 31,920,546 bp
  • A to T, chromosome 11 at 43,203,151 bp
  • T to C, chromosome 11 at 79,441,665 bp
  • A to C, chromosome 11 at 86,189,772 bp
  • T to G, chromosome 11 at 89,391,776 bp
  • C to A, chromosome 11 at 102,460,861 bp
  • A to C, chromosome 12 at 24,710,471 bp
  • T to A, chromosome 13 at 9,623,798 bp
  • T to C, chromosome 13 at 56,822,499 bp
  • A to T, chromosome 13 at 58,329,004 bp
  • A to G, chromosome 14 at 37,072,530 bp
  • G to C, chromosome 16 at 3,985,594 bp
  • A to G, chromosome 16 at 8,482,314 bp
  • T to C, chromosome 16 at 20,600,766 bp
  • T to A, chromosome 16 at 20,618,538 bp
  • T to A, chromosome 16 at 37,033,531 bp
  • T to C, chromosome 16 at 38,609,428 bp
  • T to A, chromosome 16 at 59,201,901 bp
  • A to G, chromosome 16 at 94,335,864 bp
  • T to A, chromosome 17 at 23,996,688 bp
  • A to T, chromosome 17 at 53,507,869 bp
  • A to T, chromosome 18 at 37,309,002 bp
  • A to T, chromosome 18 at 62,533,516 bp
  • C to T, chromosome 19 at 23,244,058 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8815 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068650-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.