Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8815Btlr/Mmmh
Stock Number:
068650-MU
Citation ID:
RRID:MMRRC_068650-MU
Other Names:
R8815 (G1)
Major Collection:

Strain Information

Sptbn4
Name: spectrin beta, non-erythrocytic 4
Synonyms: dyn, SpbIV, neuroaxonal dystrophy, 5830426A08Rik, ROSA62, nmf261, 1700022P15Rik, Spnb4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 80297
Homologene: 11879
Pias3
Name: protein inhibitor of activated STAT 3
Synonyms: Pias3L
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229615
Homologene: 4447
Spns1
Name: SPNS lysolipid transporter 1, lysophospholipid
Synonyms: 2210013K02Rik, spinster homolog
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73658
Homologene: 41530
Ip6k1
Name: inositol hexaphosphate kinase 1
Synonyms: InsP6, 1200016D08Rik, Ihpk1, InsP6k1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27399
Homologene: 56602
Ptprf
Name: protein tyrosine phosphatase receptor type F
Synonyms: LAR, RPTP-LAR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19268
HGNC: HGNC:9670
Homologene: 20623
Tanc1
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms: 1200003E16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66860
Homologene: 18946
Pepd
Name: peptidase D
Synonyms: Pep-4, peptidase D, Pep4, dal
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18624
HGNC: HGNC:8840
Homologene: 239
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 37,890,234 bp
  • A to T, chromosome 1 at 57,382,784 bp
  • T to A, chromosome 1 at 132,939,093 bp
  • G to T, chromosome 1 at 191,177,367 bp
  • G to T, chromosome 2 at 37,068,417 bp
  • A to T, chromosome 2 at 40,665,159 bp
  • A to G, chromosome 2 at 59,790,841 bp
  • C to T, chromosome 2 at 76,798,020 bp
  • A to T, chromosome 2 at 76,867,900 bp
  • G to A, chromosome 2 at 155,024,618 bp
  • T to C, chromosome 3 at 36,085,441 bp
  • C to T, chromosome 3 at 94,324,303 bp
  • T to C, chromosome 3 at 96,700,065 bp
  • T to C, chromosome 4 at 33,226,045 bp
  • A to G, chromosome 4 at 47,113,908 bp
  • A to G, chromosome 4 at 65,181,110 bp
  • A to T, chromosome 4 at 65,912,597 bp
  • C to A, chromosome 4 at 118,237,928 bp
  • T to A, chromosome 4 at 130,819,025 bp
  • T to A, chromosome 4 at 154,026,748 bp
  • A to G, chromosome 5 at 25,953,193 bp
  • A to G, chromosome 5 at 143,894,518 bp
  • G to T, chromosome 5 at 150,394,138 bp
  • T to A, chromosome 7 at 17,759,360 bp
  • G to A, chromosome 7 at 27,407,232 bp
  • T to A, chromosome 7 at 30,754,802 bp
  • A to G, chromosome 7 at 34,971,691 bp
  • C to T, chromosome 7 at 51,544,800 bp
  • A to G, chromosome 7 at 80,383,871 bp
  • T to A, chromosome 7 at 98,499,035 bp
  • T to C, chromosome 7 at 103,418,317 bp
  • A to G, chromosome 7 at 103,777,856 bp
  • G to A, chromosome 7 at 126,372,421 bp
  • G to C, chromosome 7 at 127,558,865 bp
  • GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG to GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG, chromosome 7 at 142,240,434 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • C to A, chromosome 8 at 3,380,410 bp
  • T to A, chromosome 8 at 35,590,240 bp
  • A to T, chromosome 8 at 65,036,938 bp
  • A to G, chromosome 8 at 66,864,681 bp
  • A to T, chromosome 8 at 71,253,266 bp
  • A to G, chromosome 8 at 92,914,351 bp
  • C to T, chromosome 8 at 104,250,928 bp
  • A to T, chromosome 9 at 21,026,566 bp
  • G to A, chromosome 9 at 106,199,038 bp
  • A to G, chromosome 9 at 108,041,012 bp
  • G to A, chromosome 9 at 109,276,237 bp
  • A to G, chromosome 10 at 51,620,983 bp
  • A to T, chromosome 10 at 120,112,787 bp
  • C to T, chromosome 10 at 127,710,174 bp
  • T to A, chromosome 10 at 130,111,939 bp
  • G to A, chromosome 11 at 31,920,546 bp
  • A to T, chromosome 11 at 43,203,151 bp
  • T to C, chromosome 11 at 79,441,665 bp
  • A to C, chromosome 11 at 86,189,772 bp
  • T to G, chromosome 11 at 89,391,776 bp
  • C to A, chromosome 11 at 102,460,861 bp
  • A to C, chromosome 12 at 24,710,471 bp
  • T to A, chromosome 13 at 9,623,798 bp
  • T to C, chromosome 13 at 56,822,499 bp
  • A to T, chromosome 13 at 58,329,004 bp
  • A to G, chromosome 14 at 37,072,530 bp
  • G to C, chromosome 16 at 3,985,594 bp
  • A to G, chromosome 16 at 8,482,314 bp
  • T to C, chromosome 16 at 20,600,766 bp
  • T to A, chromosome 16 at 20,618,538 bp
  • T to A, chromosome 16 at 37,033,531 bp
  • T to C, chromosome 16 at 38,609,428 bp
  • T to A, chromosome 16 at 59,201,901 bp
  • A to G, chromosome 16 at 94,335,864 bp
  • T to A, chromosome 17 at 23,996,688 bp
  • A to T, chromosome 17 at 53,507,869 bp
  • A to T, chromosome 18 at 37,309,002 bp
  • A to T, chromosome 18 at 62,533,516 bp
  • C to T, chromosome 19 at 23,244,058 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8815 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068650-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.