Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8820Btlr/Mmmh
Stock Number:
068653-MU
Citation ID:
RRID:MMRRC_068653-MU
Other Names:
R8820 (G1)
Major Collection:

Strain Information

Npr1
Name: natriuretic peptide receptor 1
Synonyms: NPRA, GC-A, NPR-A, guanylyl cyclase-A
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18160
HGNC: HGNC:7943
Homologene: 37367
Gldc
Name: glycine decarboxylase
Synonyms: D19Wsu57e, D030049L12Rik, b2b2679Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104174
VEGA: 19
HGNC: HGNC:4313
Homologene: 141
Ldb2
Name: LIM domain binding 2
Synonyms: CLIM1, Ldb3, CLP-36, CLIM-1b, CLIM-1a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16826
HGNC: HGNC:6533
Homologene: 989
Clasrp
Name: CLK4-associating serine/arginine rich protein
Synonyms: SWAP2, Srsf16, Sfrs16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53609
Homologene: 134306
Cemip2
Name: cell migration inducing hyaluronidase 2
Synonyms: 3110012M15Rik, Tmem2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83921
VEGA: 19
Homologene: 75008
Sema4b
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B
Synonyms: SemC, Semac
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20352
Homologene: 8426
Cdyl
Name: chromodomain protein, Y chromosome-like
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12593
VEGA: 13
HGNC: HGNC:1811
Homologene: 3548
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 58,476,480 bp
  • T to A, chromosome 1 at 67,228,280 bp
  • T to A, chromosome 1 at 105,726,454 bp
  • A to G, chromosome 1 at 111,860,264 bp
  • T to C, chromosome 1 at 133,915,140 bp
  • T to A, chromosome 1 at 169,977,914 bp
  • T to A, chromosome 1 at 189,899,821 bp
  • C to T, chromosome 2 at 24,159,880 bp
  • T to C, chromosome 2 at 36,376,994 bp
  • C to A, chromosome 2 at 36,890,610 bp
  • T to C, chromosome 2 at 59,504,712 bp
  • G to A, chromosome 2 at 112,635,792 bp
  • A to G, chromosome 2 at 112,859,724 bp
  • T to A, chromosome 2 at 143,801,070 bp
  • T to A, chromosome 3 at 89,175,423 bp
  • G to A, chromosome 3 at 90,464,894 bp
  • T to C, chromosome 3 at 131,298,367 bp
  • T to C, chromosome 4 at 53,735,001 bp
  • C to A, chromosome 4 at 82,903,517 bp
  • C to A, chromosome 4 at 130,255,379 bp
  • A to T, chromosome 5 at 8,723,204 bp
  • G to A, chromosome 5 at 44,799,415 bp
  • A to G, chromosome 5 at 125,029,227 bp
  • A to G, chromosome 6 at 48,677,887 bp
  • A to C, chromosome 6 at 83,814,756 bp
  • T to A, chromosome 6 at 112,329,809 bp
  • C to T, chromosome 7 at 19,586,437 bp
  • T to C, chromosome 7 at 29,894,588 bp
  • T to C, chromosome 7 at 30,528,740 bp
  • T to C, chromosome 7 at 57,792,581 bp
  • C to A, chromosome 7 at 72,229,333 bp
  • G to C, chromosome 7 at 80,220,500 bp
  • T to A, chromosome 7 at 104,881,655 bp
  • T to A, chromosome 8 at 13,063,253 bp
  • T to G, chromosome 8 at 48,310,724 bp
  • C to T, chromosome 9 at 44,790,522 bp
  • T to C, chromosome 9 at 110,885,787 bp
  • T to C, chromosome 9 at 119,816,520 bp
  • T to G, chromosome 10 at 80,154,400 bp
  • G to A, chromosome 11 at 40,721,672 bp
  • T to G, chromosome 11 at 58,446,303 bp
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp
  • T to A, chromosome 12 at 81,973,248 bp
  • T to C, chromosome 13 at 35,858,191 bp
  • A to T, chromosome 13 at 50,433,315 bp
  • G to T, chromosome 13 at 92,708,036 bp
  • G to A, chromosome 14 at 48,252,673 bp
  • C to T, chromosome 14 at 54,282,613 bp
  • A to G, chromosome 14 at 70,648,328 bp
  • T to C, chromosome 15 at 97,748,657 bp
  • A to G, chromosome 17 at 24,328,602 bp
  • G to C, chromosome 17 at 58,880,720 bp
  • G to A, chromosome 18 at 9,213,247 bp
  • T to A, chromosome 18 at 37,473,918 bp
  • C to T, chromosome 18 at 44,834,464 bp
  • G to A, chromosome 19 at 21,807,454 bp
  • C to G, chromosome 19 at 30,100,812 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8820 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068653-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.