Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8821Btlr/Mmmh
Stock Number:
068654-MU
Citation ID:
RRID:MMRRC_068654-MU
Other Names:
R8821 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Clasrp
Name: CLK4-associating serine/arginine rich protein
Synonyms: SWAP2, Srsf16, Sfrs16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53609
Homologene: 134306
Phf3
Name: PHD finger protein 3
Synonyms: 2310061N19Rik, AU020177
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213109
HGNC: HGNC:8921
Homologene: 9040
Usp48
Name: ubiquitin specific peptidase 48
Synonyms: D330022K21Rik, 2810449C13Rik, Usp31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 170707
Homologene: 12988
Helz
Name: helicase with zinc finger domain
Synonyms: 9630002H22Rik, 9430093I07Rik, 3110078M01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78455
Homologene: 8918
Lima1
Name: LIM domain and actin binding 1
Synonyms: 1110021C24Rik, 3526402A12Rik, epithelial protein lost in neoplasm, EPLIN
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 65970
Homologene: 9484
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 30,821,266 bp
  • T to C, chromosome 1 at 34,444,364 bp
  • A to T, chromosome 1 at 34,472,190 bp
  • T to C, chromosome 1 at 162,968,838 bp
  • C to A, chromosome 1 at 181,792,004 bp
  • A to T, chromosome 2 at 24,349,493 bp
  • G to A, chromosome 2 at 36,479,782 bp
  • A to G, chromosome 2 at 84,667,257 bp
  • A to G, chromosome 2 at 89,590,536 bp
  • T to A, chromosome 2 at 91,118,179 bp
  • A to T, chromosome 2 at 97,629,695 bp
  • G to A, chromosome 2 at 121,360,821 bp
  • T to C, chromosome 2 at 144,617,341 bp
  • T to A, chromosome 2 at 153,676,814 bp
  • T to C, chromosome 2 at 181,586,732 bp
  • G to A, chromosome 3 at 68,962,250 bp
  • T to C, chromosome 3 at 83,285,363 bp
  • A to T, chromosome 3 at 98,446,731 bp
  • A to G, chromosome 4 at 63,224,911 bp
  • A to G, chromosome 4 at 104,790,677 bp
  • A to T, chromosome 4 at 120,567,310 bp
  • A to T, chromosome 4 at 137,613,769 bp
  • G to A, chromosome 4 at 149,646,323 bp
  • A to G, chromosome 5 at 34,459,030 bp
  • G to A, chromosome 5 at 107,720,272 bp
  • A to T, chromosome 5 at 109,676,308 bp
  • T to A, chromosome 5 at 134,135,253 bp
  • C to T, chromosome 7 at 19,586,437 bp
  • A to T, chromosome 7 at 29,204,936 bp
  • A to G, chromosome 7 at 45,156,772 bp
  • A to G, chromosome 7 at 50,826,349 bp
  • G to A, chromosome 7 at 64,354,501 bp
  • A to G, chromosome 7 at 99,735,686 bp
  • A to T, chromosome 8 at 12,279,688 bp
  • A to T, chromosome 8 at 36,146,737 bp
  • C to T, chromosome 8 at 48,276,382 bp
  • G to A, chromosome 8 at 95,062,217 bp
  • A to T, chromosome 8 at 106,210,557 bp
  • A to G, chromosome 8 at 119,749,294 bp
  • A to G, chromosome 9 at 21,580,367 bp
  • T to A, chromosome 9 at 107,300,472 bp
  • T to C, chromosome 9 at 108,564,758 bp
  • A to G, chromosome 10 at 18,652,743 bp
  • A to G, chromosome 10 at 84,613,658 bp
  • G to A, chromosome 10 at 130,391,099 bp
  • A to T, chromosome 11 at 60,725,248 bp
  • A to G, chromosome 11 at 61,216,316 bp
  • A to T, chromosome 11 at 62,369,408 bp
  • A to G, chromosome 11 at 63,964,480 bp
  • A to T, chromosome 11 at 81,967,900 bp
  • A to C, chromosome 11 at 94,350,961 bp
  • T to A, chromosome 11 at 100,703,980 bp
  • A to T, chromosome 11 at 103,619,644 bp
  • A to T, chromosome 11 at 107,635,093 bp
  • A to T, chromosome 11 at 110,058,536 bp
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp
  • CCCGCGCGGCGGCCTGCACTGCGCCGCCGCGGCCGCCCTGGGAGCCGGCCCTGCCGCG to CCCGCG, chromosome 11 at 120,598,197 bp
  • C to A, chromosome 13 at 47,064,141 bp
  • C to T, chromosome 14 at 31,296,498 bp
  • G to A, chromosome 14 at 48,252,673 bp
  • T to C, chromosome 14 at 61,607,532 bp
  • C to T, chromosome 14 at 72,480,096 bp
  • A to G, chromosome 15 at 39,754,789 bp
  • T to A, chromosome 15 at 99,280,852 bp
  • T to A, chromosome 15 at 99,806,425 bp
  • T to A, chromosome 15 at 102,358,792 bp
  • C to T, chromosome 16 at 20,550,464 bp
  • A to G, chromosome 17 at 6,139,134 bp
  • T to C, chromosome 17 at 29,211,694 bp
  • T to C, chromosome 17 at 30,794,738 bp
  • A to T, chromosome 17 at 53,400,744 bp
  • A to G, chromosome 17 at 65,436,372 bp
  • T to A, chromosome 17 at 78,492,540 bp
  • T to A, chromosome 18 at 12,200,820 bp
  • T to C, chromosome 18 at 20,320,308 bp
  • A to G, chromosome 18 at 37,437,333 bp
  • A to G, chromosome 19 at 4,269,025 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8821 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068654-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.