Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8823Btlr/Mmmh
Stock Number:
068656-MU
Citation ID:
RRID:MMRRC_068656-MU
Other Names:
R8823 (G1)
Major Collection:

Strain Information

Emx2
Name: empty spiracles homeobox 2
Synonyms: Pdo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13797
HGNC: HGNC:3341
Homologene: 3023
Trmo
Name: tRNA methyltransferase O
Synonyms: 5830415F09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74753
Homologene: 32316
Ptpn12
Name: protein tyrosine phosphatase, non-receptor type 12
Synonyms: P19-PTP, PTP-PEST, PTP-P19
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19248
HGNC: HGNC:9645
Homologene: 37691
Rtn4
Name: reticulon 4
Synonyms: 1110020G17Rik, C130026I10Rik, NOGO, NgA, Nogo-B, Nogo-A
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68585
Homologene: 10743
Xpo1
Name: exportin 1
Synonyms: Crm1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103573
Homologene: 2554
Prpf8
Name: pre-mRNA processing factor 8
Synonyms: DBF3/PRP8, Prp8, D11Bwg0410e, Sfprp8l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192159
Homologene: 4706
Myo1d
Name: myosin ID
Synonyms: 9930104H07Rik, D11Ertd9e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 338367
HGNC: HGNC:7598
Homologene: 45576
Ipo9
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226432
Homologene: 5874
Polr1b
Name: polymerase (RNA) I polypeptide B
Synonyms: RPA2, RPA116, 128kDa, D630020H17Rik, Rpo1-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20017
Homologene: 7133
Zbtb21
Name: zinc finger and BTB domain containing 21
Synonyms: Znf295, 5430437K12Rik, B430213I24Rik, Zfp295
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 114565
VEGA: 16
Homologene: 10799
Ap5z1
Name: adaptor-related protein complex 5, zeta 1 subunit
Synonyms: C330006K01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231855
Homologene: 18213
Kank4
Name: KN motif and ankyrin repeat domains 4
Synonyms: Ankrd38
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242553
Homologene: 18244
Snrpd2
Name: small nuclear ribonucleoprotein D2
Synonyms: 1810009A06Rik, SMD2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 107686
Homologene: 3381
Zfp105
Name: zinc finger protein 105
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22646
Homologene: 2568
Galnt12
Name: polypeptide N-acetylgalactosaminyltransferase 12
Synonyms: A630062B03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230145
Homologene: 11637
Pdcd1
Name: programmed cell death 1
Synonyms: PD-1, Pdc1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18566
HGNC: HGNC:8760
Homologene: 3681
Zbtb41
Name: zinc finger and BTB domain containing 41
Synonyms: 8430415N23Rik, 9830132G07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226470
Homologene: 27795
Sybu
Name: syntabulin (syntaxin-interacting)
Synonyms: A830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 319613
VEGA: 15
Homologene: 9838
Hrc
Name: histidine rich calcium binding protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15464
HGNC: HGNC:5178
Homologene: 137234
Slc35b2
Name: solute carrier family 35, member B2
Synonyms: 1110003M08Rik, PAPST1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73836
VEGA: 17
Homologene: 24504
Ifi208
Name: interferon activated gene 208
Synonyms: E430029J22Rik, Pydc3, Pyr-rv1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100033459
Homologene: 115929
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MyHC-IIa, MHC2A, Myhs-f1, Myhs-f, Myhsf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Xkr9
Name: X-linked Kx blood group related 9
Synonyms: LOC381246
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381246
Homologene: 20056
Grin2a
Name: glutamate receptor, ionotropic, NMDA2A (epsilon 1)
Synonyms: NR2A, NMDAR2A, GluRepsilon1, GluN2A
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14811
HGNC: HGNC:4585
Homologene: 645
Mug2
Name: murinoglobulin 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17837
HGNC: HGNC:9750
Homologene: 136663
Ceacam20
Name: CEA cell adhesion molecule 20
Synonyms: 9130012D09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71601
Homologene: 19010
Adam24
Name: ADAM metallopeptidase domain 24
Synonyms: Dtgn5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13526
HGNC: HGNC:203
Homologene: 137232
Fah
Name: fumarylacetoacetate hydrolase
Synonyms: swst
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14085
HGNC: HGNC:3579
Homologene: 110
Etnppl
Name: ethanolamine phosphate phospholyase
Synonyms: 1300019H02Rik, Agxt2l1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71760
Homologene: 69440
Selplg
Name: selectin, platelet (p-selectin) ligand
Synonyms: Psgl-1, Psgl1, CD162
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20345
Homologene: 2261
Lrtm2
Name: leucine-rich repeats and transmembrane domains 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211187
Homologene: 65244
Kcnd3
Name: potassium voltage-gated channel, Shal-related family, member 3
Synonyms: potassium channel Kv4.3M, potassium channel Kv4.3L, Kv4.3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56543
HGNC: HGNC:6239
Homologene: 21036
Slc38a3
Name: solute carrier family 38, member 3
Synonyms: 0610012J02Rik, D9Ucla2, Snat3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76257
Homologene: 4983
Vmn1r225
Name: vomeronasal 1 receptor 225
Synonyms: V1re5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171228
Sesn3
Name: sestrin 3
Synonyms: SEST3, 5630400E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75747
Homologene: 14386
Hace1
Name: HECT domain and ankyrin repeat containing, E3 ubiquitin protein ligase 1
Synonyms: A730034A22Rik, 1700042J16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 209462
Homologene: 10807
Igsf5
Name: immunoglobulin superfamily, member 5
Synonyms: 2010003D20Rik, Igsf5, Jam4
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72058
HGNC: HGNC:5952
Homologene: 12437
Chfr
Name: checkpoint with forkhead and ring finger domains
Synonyms: RNF116, 5730484M20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231600
Homologene: 10078
Or10a3n
Name: olfactory receptor family 10 subfamily A member 3N
Synonyms: GA_x6K02T2PBJ9-11224559-11223615, MOR268-6, Olfr519
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277935
Homologene: 17186
Psmc2
Name: proteasome (prosome, macropain) 26S subunit, ATPase 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19181
HGNC: HGNC:9548
Homologene: 2096
Gbx1
Name: gastrulation brain homeobox 1
Synonyms: Gbx-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231044
HGNC: HGNC:4185
Homologene: 41063
Rilpl2
Name: Rab interacting lysosomal protein-like 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80291
Homologene: 12723
Tes3-ps
Name: testis derived transcript 3, pseudogene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 54339
VEGA: 13
Atg5lrt
Name: ATP synthase, H+ transporting, mitochondrial F0 complex, subunit G, retrotransposed
Synonyms: Gm5426
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432491
VEGA: 10
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 13,672,608 bp
  • T to C, chromosome 1 at 94,041,495 bp
  • A to G, chromosome 1 at 135,419,339 bp
  • A to G, chromosome 1 at 139,423,154 bp
  • A to G, chromosome 1 at 173,683,536 bp
  • T to C, chromosome 2 at 129,125,537 bp
  • T to C, chromosome 3 at 105,667,014 bp
  • G to A, chromosome 3 at 130,626,546 bp
  • T to C, chromosome 4 at 46,382,604 bp
  • G to T, chromosome 4 at 47,091,928 bp
  • A to T, chromosome 4 at 98,780,003 bp
  • A to G, chromosome 5 at 20,998,623 bp
  • T to A, chromosome 5 at 21,800,576 bp
  • A to G, chromosome 5 at 24,505,053 bp
  • G to A, chromosome 5 at 110,152,392 bp
  • GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT to GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT, chromosome 5 at 113,819,695 bp
  • C to T, chromosome 5 at 124,468,653 bp
  • T to C, chromosome 5 at 142,474,436 bp
  • T to C, chromosome 6 at 68,437,871 bp
  • T to A, chromosome 6 at 119,317,232 bp
  • A to T, chromosome 6 at 122,063,689 bp
  • T to C, chromosome 7 at 19,152,610 bp
  • A to T, chromosome 7 at 19,971,504 bp
  • A to G, chromosome 7 at 45,336,298 bp
  • A to G, chromosome 7 at 84,605,717 bp
  • A to G, chromosome 7 at 108,893,948 bp
  • T to A, chromosome 8 at 40,680,189 bp
  • T to A, chromosome 9 at 14,310,240 bp
  • A to C, chromosome 9 at 107,655,951 bp
  • A to G, chromosome 9 at 122,930,503 bp
  • T to C, chromosome 10 at 45,648,860 bp
  • A to T, chromosome 10 at 96,136,771 bp
  • C to T, chromosome 10 at 119,975,951 bp
  • A to T, chromosome 11 at 23,267,752 bp
  • T to A, chromosome 11 at 29,706,609 bp
  • A to T, chromosome 11 at 67,185,474 bp
  • T to A, chromosome 11 at 75,493,456 bp
  • A to T, chromosome 11 at 80,601,745 bp
  • A to G, chromosome 12 at 115,067,647 bp
  • A to T, chromosome 13 at 49,494,216 bp
  • C to A, chromosome 15 at 44,677,602 bp
  • T to A, chromosome 16 at 9,669,894 bp
  • C to T, chromosome 16 at 96,421,739 bp
  • G to A, chromosome 16 at 97,951,316 bp
  • A to G, chromosome 17 at 8,566,401 bp
  • A to G, chromosome 17 at 20,502,561 bp
  • T to A, chromosome 17 at 45,566,968 bp
  • A to G, chromosome 19 at 59,459,448 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8823 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068656-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.