Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8843Btlr/Mmmh
Stock Number:
068670-MU
Citation ID:
RRID:MMRRC_068670-MU
Other Names:
R8843 (G1)
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Phf20
Name: PHD finger protein 20
Synonyms: 6820402O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228829
Homologene: 9507
Zfp273
Name: zinc finger protein 273
Synonyms: 6820416H06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212569
Homologene: 133729
Ncaph
Name: non-SMC condensin I complex, subunit H
Synonyms: HCAP-H, A730011O11Rik, Brrn1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215387
HGNC: HGNC:1112
Homologene: 133986
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 6,245,171 bp
  • A to G, chromosome 1 at 60,453,729 bp
  • G to A, chromosome 1 at 75,129,627 bp
  • T to A, chromosome 1 at 164,935,510 bp
  • T to C, chromosome 2 at 13,657,085 bp
  • A to C, chromosome 2 at 37,085,295 bp
  • G to T, chromosome 2 at 70,257,981 bp
  • T to C, chromosome 2 at 76,765,769 bp
  • A to T, chromosome 2 at 76,848,915 bp
  • TC to TCGAC, chromosome 2 at 98,663,806 bp
  • G to A, chromosome 2 at 104,437,897 bp
  • A to G, chromosome 2 at 127,108,609 bp
  • C to T, chromosome 2 at 156,302,923 bp
  • T to A, chromosome 2 at 163,012,970 bp
  • T to C, chromosome 2 at 178,348,259 bp
  • A to G, chromosome 3 at 31,257,610 bp
  • A to T, chromosome 3 at 73,048,831 bp
  • A to G, chromosome 3 at 85,661,011 bp
  • A to T, chromosome 3 at 108,396,127 bp
  • A to G, chromosome 4 at 101,137,745 bp
  • A to T, chromosome 4 at 125,063,621 bp
  • A to T, chromosome 4 at 141,764,691 bp
  • G to T, chromosome 5 at 23,775,756 bp
  • T to A, chromosome 5 at 34,889,465 bp
  • A to T, chromosome 5 at 35,280,363 bp
  • A to G, chromosome 6 at 12,501,137 bp
  • A to T, chromosome 6 at 29,923,969 bp
  • G to T, chromosome 6 at 85,910,925 bp
  • A to C, chromosome 6 at 127,729,499 bp
  • A to G, chromosome 7 at 5,093,376 bp
  • A to T, chromosome 7 at 30,789,527 bp
  • G to T, chromosome 7 at 45,348,517 bp
  • A to G, chromosome 7 at 90,376,126 bp
  • T to C, chromosome 7 at 114,221,700 bp
  • A to C, chromosome 7 at 140,249,000 bp
  • TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG to TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG, chromosome 8 at 104,309,702 bp
  • A to T, chromosome 8 at 109,925,799 bp
  • C to G, chromosome 9 at 21,529,035 bp
  • T to C, chromosome 9 at 67,395,545 bp
  • T to A, chromosome 9 at 116,006,501 bp
  • C to A, chromosome 10 at 5,193,040 bp
  • T to C, chromosome 10 at 5,330,204 bp
  • A to G, chromosome 10 at 59,369,633 bp
  • C to A, chromosome 10 at 76,075,091 bp
  • A to G, chromosome 10 at 128,578,456 bp
  • A to T, chromosome 11 at 84,519,629 bp
  • A to C, chromosome 11 at 98,189,276 bp
  • A to G, chromosome 11 at 105,401,976 bp
  • T to G, chromosome 12 at 55,492,411 bp
  • T to A, chromosome 12 at 69,926,148 bp
  • T to G, chromosome 12 at 102,369,598 bp
  • A to T, chromosome 13 at 67,442,645 bp
  • A to T, chromosome 13 at 67,822,268 bp
  • C to T, chromosome 13 at 97,994,049 bp
  • A to G, chromosome 14 at 33,954,565 bp
  • T to C, chromosome 14 at 40,892,875 bp
  • T to G, chromosome 14 at 54,975,295 bp
  • T to A, chromosome 15 at 19,013,401 bp
  • A to G, chromosome 15 at 72,006,654 bp
  • A to T, chromosome 15 at 74,716,019 bp
  • G to A, chromosome 15 at 100,682,940 bp
  • A to T, chromosome 16 at 20,120,230 bp
  • A to G, chromosome 16 at 20,236,636 bp
  • A to G, chromosome 16 at 33,750,493 bp
  • A to G, chromosome 16 at 37,011,918 bp
  • A to T, chromosome 16 at 43,973,864 bp
  • T to A, chromosome 16 at 45,127,107 bp
  • G to A, chromosome 17 at 17,552,941 bp
  • A to C, chromosome 17 at 22,548,030 bp
  • G to A, chromosome 17 at 34,600,742 bp
  • A to G, chromosome 17 at 48,366,824 bp
  • T to C, chromosome 19 at 4,097,429 bp
  • G to T, chromosome 19 at 6,505,027 bp
  • G to A, chromosome 19 at 53,371,695 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8843 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068670-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.