Strain Name:
C57BL/6J-MtgxR8843Btlr/Mmmh
Stock Number:
068670-MU
Citation ID:
RRID:MMRRC_068670-MU
Other Names:
R8843 (G1)
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: MYH-beta/slow, beta-MHC, MyHC-I, B-MHC, Myhcb, Myhc-b, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Nrxn2
Name: neurexin II
Synonyms: 6430591O13Rik, neurexin II beta, neurexin II alpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, PBP, CRSP210, DRIP205, Pparbp, l11Jus15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Phf20
Name: PHD finger protein 20
Synonyms: 6820402O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228829
Homologene: 9507
Zfp273
Name: zinc finger protein 273
Synonyms: 6820416H06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212569
Homologene: 133729
Ncaph
Name: non-SMC condensin I complex, subunit H
Synonyms: HCAP-H, A730011O11Rik, Brrn1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215387
HGNC: HGNC:1112
Homologene: 133986
Copb1
Name: coatomer protein complex, subunit beta 1
Synonyms: Copb1, 2610019B04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70349
HGNC: HGNC:2231
Homologene: 5664
Klhl24
Name: kelch-like 24
Synonyms: 4930429H24Rik, 1110046J11Rik, 6530402O20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 75785
VEGA: 16
Homologene: 32352
Abi2
Name: abl interactor 2
Synonyms: 8430425M24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329165
Homologene: 4209
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: SYNE-1, A330049M09Rik, enaptin165, nesprin-1, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Ccdc80
Name: coiled-coil domain containing 80
Synonyms: Ssg1, DRO1, Urb, 2610001E17Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67896
Homologene: 12206
Adra2c
Name: adrenergic receptor, alpha 2c
Synonyms: Adra-2c, alpha2-C4, alpha2C, subtype alpha2-C4, [a]2C
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11553
HGNC: HGNC:283
Homologene: 20170
Mxi1
Name: MAX interactor 1, dimerization protein
Synonyms: bHLHc11, Mad2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17859
VEGA: 19
HGNC: HGNC:7534
Homologene: 4351
Erbb3
Name: erb-b2 receptor tyrosine kinase 3
Synonyms: Erbb3r, HER3, Erbb-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13867
HGNC: HGNC:3431
Homologene: 20457
Slitrk3
Name: SLIT and NTRK-like family, member 3
Synonyms: ST3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 386750
Homologene: 8955
Strip2
Name: striatin interacting protein 2
Synonyms: D330017J20Rik, Fam40b, Myoscape
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320609
Homologene: 66198
Treml1
Name: triggering receptor expressed on myeloid cells-like 1
Synonyms: 5430401J17Rik, TLT-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71326
VEGA: 17
Homologene: 52257
Htt
Name: huntingtin
Synonyms: Hdh, huntingtin, htt, HD, IT15, C430023I11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15194
HGNC: HGNC:4851
Homologene: 1593
Lnpep
Name: leucyl/cystinyl aminopeptidase
Synonyms: 4732490P18Rik, vp165, gp160, IRAP, 2010309L07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240028
VEGA: 17
HGNC: HGNC:6656
Homologene: 21148
Dnajc16
Name: DnaJ heat shock protein family (Hsp40) member C16
Synonyms: 4732437J24Rik, 2900037O03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214063
Homologene: 45414
Raver2
Name: ribonucleoprotein, PTB-binding 2
Synonyms: A430091O22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242570
Homologene: 18829
Zfp874a
Name: zinc finger protein 874a
Synonyms: Rslcan15, C330011K17Rik, Zfp874
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238692
Homologene: 135597
Nfkbia
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, alpha
Synonyms: I(Kappa)B(alpha), IkappaBalpha, Nfkbi, I-kappaBalpha
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18035
VEGA: 12
HGNC: HGNC:7797
Homologene: 7863
Atl1
Name: atlastin GTPase 1
Synonyms: AD-FSP, FSP1, SPG3, Spg3a
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73991
VEGA: 12
Homologene: 9302
Rbp3
Name: retinol binding protein 3, interstitial
Synonyms: Irbp, Rbp-3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19661
VEGA: 14
HGNC: HGNC:9921
Homologene: 9261
Arhgef28
Name: Rho guanine nucleotide exchange factor 28
Synonyms: D13Bwg1089e, p190RhoGEF, RIP2, Rho specific exchange factor, RhoGEF, 9230110L08Rik, Rgnef
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110596
VEGA: 13
Homologene: 8078
Psca
Name: prostate stem cell antigen
Synonyms: 2210408B04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72373
HGNC: HGNC:9500
Homologene: 4150
Fhip1a
Name: FHF complex subunit HOOK interacting protein 1A
Synonyms: Fam160a1, 9930021J17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229488
Homologene: 85149
Ttn
Name: titin
Synonyms: connectin, shru, D330041I19Rik, 2310057K23Rik, mdm, D830007G01Rik, 2310074I15Rik, 1100001C23Rik, 2310036G12Rik, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pus7
Name: pseudouridylate synthase 7
Synonyms: C330017I15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78697
Homologene: 6998
Celsr2
Name: cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms: flamingo, mfmi1, EGFL2, Adgrc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 53883
HGNC: HGNC:3231
Homologene: 1078
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Rb1cc1
Name: RB1-inducible coiled-coil 1
Synonyms: Cc1, LaXp180, 5930404L04Rik, Fip200, 2900055E04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12421
Homologene: 7659
Scart2
Name: scavenger receptor family member expressed on T cells 2
Synonyms: 5830411N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244234
Homologene: 133218
Gm10801
Name: predicted gene 10801
Type: Gene
Species: Mouse
Chromosome: 2
Sycp2
Name: synaptonemal complex protein 2
Synonyms: 3830402K23Rik, 4930518F03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320558
Homologene: 8604
Vmn2r111
Name: vomeronasal 2, receptor 111
Synonyms: EG210876
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210876
Homologene: 86604
Slc7a14
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241919
Homologene: 76320
Myo3b
Name: myosin IIIB
Synonyms: A430065P19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329421
Homologene: 51393
Col22a1
Name: collagen, type XXII, alpha 1
Synonyms: 2310067L16Rik, C80743
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69700
Homologene: 43567
Heg1
Name: heart development protein with EGF-like domains 1
Synonyms: LOC268884, 9530025L16Rik, 4632417D23Rik, 5530401I02Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77446
Homologene: 35276
Thsd7a
Name: thrombospondin, type I, domain containing 7A
Synonyms: LOC330267
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330267
Homologene: 46582
Phlpp2
Name: PH domain and leucine rich repeat protein phosphatase 2
Synonyms: C130044A18Rik, Phlppl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244650
Homologene: 71015
Prmt8
Name: protein arginine N-methyltransferase 8
Synonyms: Hrmt1l3, Hrmt1l4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381813
HGNC: HGNC:5188
Homologene: 76124
Rin3
Name: Ras and Rab interactor 3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217835
Homologene: 11748
Sytl2
Name: synaptotagmin-like 2
Synonyms: Slp2-b, Slp2-c, Slp2-d, Slp2, Slp2-a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83671
Homologene: 131343
Gadl1
Name: glutamate decarboxylase-like 1
Synonyms: 1110027M19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73748
Homologene: 45812
Hipk3
Name: homeodomain interacting protein kinase 3
Synonyms: DYRK6, FIST3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15259
HGNC: HGNC:4915
Homologene: 55923
P4ha1
Name: procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide
Synonyms: P4ha
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18451
HGNC: HGNC:8546
Homologene: 30998
Zdhhc23
Name: zinc finger, DHHC domain containing 23
Synonyms: LOC332175, LOC385651
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 332175
VEGA: 16
Homologene: 17840
Marchf10
Name: membrane associated ring-CH-type finger 10
Synonyms: Rnf190, March10, 4933417C16Rik, OTTMUSG00000002847
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 632687
Homologene: 34988
Ppfia3
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Synonyms: 2410127E16Rik, Liprin-alpha3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76787
HGNC: HGNC:9247
Homologene: 37833
Slc5a4b
Name: solute carrier family 5 (neutral amino acid transporters, system A), member 4b
Synonyms: SAAT1, pSGLT2, SGLT3b, 2010104G07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64454
Homologene: 56968
Sgk2
Name: serum/glucocorticoid regulated kinase 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27219
Homologene: 8446
St8sia6
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6
Synonyms: 1700007J08Rik, ST8Sia VI, Siat8f
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241230
Homologene: 17112
Cdh10
Name: cadherin 10
Synonyms: T2-cadherin, C030011H18Rik, C030003B10Rik, A830016G23Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320873
HGNC: HGNC:1749
Homologene: 68530
Slc23a3
Name: solute carrier family 23 (nucleobase transporters), member 3
Synonyms: Yspl1, SVCT3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22626
Homologene: 65865
Or12k8
Name: olfactory receptor family 12 subfamily K member 8
Synonyms: GA_x6K02T2NLDC-33777519-33776551, MOR159-3, Olfr361
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258365
Homologene: 27142
Dnali1
Name: dynein, axonemal, light intermediate polypeptide 1
Synonyms: 1700023A09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75563
Homologene: 2586
Krtdap
Name: keratinocyte differentiation associated protein
Synonyms: sk221, Kdap
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 64661
Homologene: 52619
Sh2d4b
Name: SH2 domain containing 4B
Synonyms: A430109M18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328381
Homologene: 19164
Epn1
Name: epsin 1
Synonyms: Ibp1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13854
Homologene: 32172
Ager
Name: advanced glycosylation end product-specific receptor
Synonyms: RAGE
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11596
HGNC: HGNC:320
Homologene: 883
Lhx1
Name: LIM homeobox protein 1
Synonyms: Lim1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16869
HGNC: HGNC:6593
Homologene: 4068
Nat8f1
Name: N-acetyltransferase 8 (GCN5-related) family member 1
Synonyms: 1110002I11Rik, Cml1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66116
Homologene: 41446
Cela1
Name: chymotrypsin-like elastase family, member 1
Synonyms: Ela1, 1810062B19Rik, PC-TsF, Ela-1, 1810009A17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 109901
VEGA: 15
HGNC: HGNC:3308
Homologene: 20454
Cdk2ap2
Name: cyclin dependent kinase 2 associated protein 2
Synonyms: 5830466O21Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52004
Homologene: 4272
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, Cklfsf1, CKLFH1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
AB124611
Name: cDNA sequence AB124611
Synonyms: LOC382062, HIDE1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382062
Homologene: 87291
Xcl1
Name: chemokine (C motif) ligand 1
Synonyms: Scyc1, SCM-1a, Lptn, lymphotactin, ATAC, LTN, SCM-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16963
Homologene: 2250
Map6d1
Name: MAP6 domain containing 1
Synonyms: A330066I15Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208158
VEGA: 16
Homologene: 11763
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 6,245,171 bp
  • A to G, chromosome 1 at 60,453,729 bp
  • G to A, chromosome 1 at 75,129,627 bp
  • T to A, chromosome 1 at 164,935,510 bp
  • T to C, chromosome 2 at 13,657,085 bp
  • A to C, chromosome 2 at 37,085,295 bp
  • G to T, chromosome 2 at 70,257,981 bp
  • T to C, chromosome 2 at 76,765,769 bp
  • A to T, chromosome 2 at 76,848,915 bp
  • TC to TCGAC, chromosome 2 at 98,663,806 bp
  • G to A, chromosome 2 at 104,437,897 bp
  • A to G, chromosome 2 at 127,108,609 bp
  • C to T, chromosome 2 at 156,302,923 bp
  • T to A, chromosome 2 at 163,012,970 bp
  • T to C, chromosome 2 at 178,348,259 bp
  • A to G, chromosome 3 at 31,257,610 bp
  • A to T, chromosome 3 at 73,048,831 bp
  • A to G, chromosome 3 at 85,661,011 bp
  • A to T, chromosome 3 at 108,396,127 bp
  • A to G, chromosome 4 at 101,137,745 bp
  • A to T, chromosome 4 at 125,063,621 bp
  • A to T, chromosome 4 at 141,764,691 bp
  • G to T, chromosome 5 at 23,775,756 bp
  • T to A, chromosome 5 at 34,889,465 bp
  • A to T, chromosome 5 at 35,280,363 bp
  • A to G, chromosome 6 at 12,501,137 bp
  • A to T, chromosome 6 at 29,923,969 bp
  • G to T, chromosome 6 at 85,910,925 bp
  • A to C, chromosome 6 at 127,729,499 bp
  • A to G, chromosome 7 at 5,093,376 bp
  • A to T, chromosome 7 at 30,789,527 bp
  • G to T, chromosome 7 at 45,348,517 bp
  • A to G, chromosome 7 at 90,376,126 bp
  • T to C, chromosome 7 at 114,221,700 bp
  • A to C, chromosome 7 at 140,249,000 bp
  • TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG to TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG, chromosome 8 at 104,309,702 bp
  • A to T, chromosome 8 at 109,925,799 bp
  • C to G, chromosome 9 at 21,529,035 bp
  • T to C, chromosome 9 at 67,395,545 bp
  • T to A, chromosome 9 at 116,006,501 bp
  • C to A, chromosome 10 at 5,193,040 bp
  • T to C, chromosome 10 at 5,330,204 bp
  • A to G, chromosome 10 at 59,369,633 bp
  • C to A, chromosome 10 at 76,075,091 bp
  • A to G, chromosome 10 at 128,578,456 bp
  • A to T, chromosome 11 at 84,519,629 bp
  • A to C, chromosome 11 at 98,189,276 bp
  • A to G, chromosome 11 at 105,401,976 bp
  • T to G, chromosome 12 at 55,492,411 bp
  • T to A, chromosome 12 at 69,926,148 bp
  • T to G, chromosome 12 at 102,369,598 bp
  • A to T, chromosome 13 at 67,442,645 bp
  • A to T, chromosome 13 at 67,822,268 bp
  • C to T, chromosome 13 at 97,994,049 bp
  • A to G, chromosome 14 at 33,954,565 bp
  • T to C, chromosome 14 at 40,892,875 bp
  • T to G, chromosome 14 at 54,975,295 bp
  • T to A, chromosome 15 at 19,013,401 bp
  • A to G, chromosome 15 at 72,006,654 bp
  • A to T, chromosome 15 at 74,716,019 bp
  • G to A, chromosome 15 at 100,682,940 bp
  • A to T, chromosome 16 at 20,120,230 bp
  • A to G, chromosome 16 at 20,236,636 bp
  • A to G, chromosome 16 at 33,750,493 bp
  • A to G, chromosome 16 at 37,011,918 bp
  • A to T, chromosome 16 at 43,973,864 bp
  • T to A, chromosome 16 at 45,127,107 bp
  • G to A, chromosome 17 at 17,552,941 bp
  • A to C, chromosome 17 at 22,548,030 bp
  • G to A, chromosome 17 at 34,600,742 bp
  • A to G, chromosome 17 at 48,366,824 bp
  • T to C, chromosome 19 at 4,097,429 bp
  • G to T, chromosome 19 at 6,505,027 bp
  • G to A, chromosome 19 at 53,371,695 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8843 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068670-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.