Strain Name:
C57BL/6J-MtgxR8865Btlr/Mmmh
Stock Number:
068681-MU
Citation ID:
RRID:MMRRC_068681-MU
Other Names:
R8865 (G1)
Major Collection:

Strain Information

Pknox1
Name: Pbx/knotted 1 homeobox
Synonyms: PREP1, D17Wsu76e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18771
HGNC: HGNC:9022
Homologene: 3363
Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
En1
Name: engrailed 1
Synonyms: En-1, engrailed-1, Mo-en.1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13798
HGNC: HGNC:3342
Homologene: 50663
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24127
Homologene: 5894
Mllt1
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 1
Synonyms: ENL, BAM11, LTG19
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64144
VEGA: 17
HGNC: HGNC:7134
Homologene: 4339
Ppil2
Name: peptidylprolyl isomerase (cyclophilin)-like 2
Synonyms: C130078A06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66053
HGNC: HGNC:9261
Homologene: 8643
Pip5k1b
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 beta
Synonyms: Pipk5b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18719
HGNC: HGNC:8995
Homologene: 100644
Mybl2
Name: myeloblastosis oncogene-like 2
Synonyms: B-Myb, Bmyb
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17865
HGNC: HGNC:7548
Homologene: 1847
Zfp638
Name: zinc finger protein 638
Synonyms: Zfml, Np220
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18139
Homologene: 7447
Rfc1
Name: replication factor C (activator 1) 1
Synonyms: Alp145, Recc1, 140kDa, RFC140
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19687
HGNC: HGNC:9969
Homologene: 2187
Zc3h7b
Name: zinc finger CCCH type containing 7B
Synonyms: Scrg3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20286
VEGA: 15
Homologene: 9735
Pawr
Name: PRKC, apoptosis, WT1, regulator
Synonyms: 2310001G03Rik, Par4, Par-4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 114774
VEGA: 10
HGNC: HGNC:8614
Homologene: 1940
Nbr1
Name: NBR1, autophagy cargo receptor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17966
HGNC: HGNC:6746
Homologene: 7438
Prss16
Name: serine protease 16 (thymus)
Synonyms: TSSP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 54373
HGNC: HGNC:9480
Homologene: 38106
Tnfrsf21
Name: tumor necrosis factor receptor superfamily, member 21
Synonyms: TR7, Death receptor 6, DR6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 94185
VEGA: 17
Homologene: 8696
Polr3c
Name: polymerase (RNA) III (DNA directed) polypeptide C
Synonyms: RPC62, 4933407E01Rik, RPC3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74414
Homologene: 38185
Dcdc2a
Name: doublecortin domain containing 2a
Synonyms: Dcdc2, RU2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 195208
Homologene: 9483
Ass1
Name: argininosuccinate synthetase 1
Synonyms: Ass-1, fold, ASS
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11898
HGNC: HGNC:758
Homologene: 6899
Mcf2l
Name: mcf.2 transforming sequence-like
Synonyms: Dbs, C130040G20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17207
Homologene: 11804
Hk1
Name: hexokinase 1
Synonyms: Hk-1, Hk1-s, mHk1-s
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 15275
HGNC: HGNC:4922
Homologene: 100530
Npat
Name: nuclear protein in the AT region
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244879
HGNC: HGNC:7896
Homologene: 1888
Tln1
Name: talin 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21894
Homologene: 21267
Cog1
Name: component of oligomeric golgi complex 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16834
HGNC: HGNC:6545
Homologene: 8411
Chd6
Name: chromodomain helicase DNA binding protein 6
Synonyms: 5430439G14Rik, 6330406J24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71389
Homologene: 32772
Cdc123
Name: cell division cycle 123
Synonyms: G431001I09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98828
Homologene: 4394
Pde12
Name: phosphodiesterase 12
Synonyms: E430028B21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 211948
Homologene: 14272
Prdm10
Name: PR domain containing 10
Synonyms: tristanin, LOC382066
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382066
Homologene: 45718
Cep192
Name: centrosomal protein 192
Synonyms: D430014P18Rik, 4631422C13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 70799
VEGA: 18
Homologene: 73526
Col4a3
Name: collagen, type IV, alpha 3
Synonyms: alpha3(IV), tumstatin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12828
HGNC: HGNC:2204
Homologene: 68033
Sirt4
Name: sirtuin 4
Synonyms: 4930596O17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75387
Homologene: 8164
Foxp2
Name: forkhead box P2
Synonyms: D0Kist7, 2810043D05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 114142
Homologene: 134404
Med12l
Name: mediator complex subunit 12-like
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329650
Homologene: 43143
Ttn
Name: titin
Synonyms: connectin, shru, D330041I19Rik, 2310057K23Rik, mdm, D830007G01Rik, 2310074I15Rik, 1100001C23Rik, 2310036G12Rik, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pramel4
Name: PRAME like 4
Synonyms: D4Ertd792e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 347710
Homologene: 133722
Irs1
Name: insulin receptor substrate 1
Synonyms: IRS-1, G972R
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16367
HGNC: HGNC:6125
Homologene: 4049
F3
Name: coagulation factor III
Synonyms: CD142, Cf3, Cf-3, tissue factor, TF
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14066
HGNC: HGNC:3541
Homologene: 1511
Map6
Name: microtubule-associated protein 6
Synonyms: Mtap6, F-STOP, 2810411E12Rik, STOP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17760
HGNC: HGNC:6868
Homologene: 7850
Insr
Name: insulin receptor
Synonyms: IR-B, 4932439J01Rik, D630014A15Rik, IR, CD220, IR-A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16337
HGNC: HGNC:6091
Homologene: 20090
Adamts2
Name: ADAM metallopeptidase with thrombospondin type 1 motif 2
Synonyms: hPCPNI, a disintegrin and metalloproteinase with thrombospondin repeats, procollagen N-proteinase, ADAM-TS2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216725
HGNC: HGNC:218
Homologene: 8597
Or2j3
Name: olfactory receptor family 2 subfamily J member 3
Synonyms: Olfr137, MOR256-18, GA_x6K02T2PSCP-2749525-2748587
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258481
Homologene: 128084
Chl1
Name: cell adhesion molecule L1-like
Synonyms: LICAM2, CALL, close homolog of L1, A530023M13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12661
HGNC: HGNC:1939
Homologene: 21314
Plcxd1
Name: phosphatidylinositol-specific phospholipase C, X domain containing 1
Synonyms: A330045H12Rik, LOC231597
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 403178
Homologene: 138628
Ccdc148
Name: coiled-coil domain containing 148
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227933
Homologene: 16353
Mat1a
Name: methionine adenosyltransferase 1A
Synonyms: MAT, SAMS1, AdoMet, Ams, MATA1, SAMS
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11720
VEGA: 14
HGNC: HGNC:6903
Homologene: 68057
Vwa5b1
Name: von Willebrand factor A domain containing 5B1
Synonyms: 4931403E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75718
Homologene: 19431
Cwh43
Name: cell wall biogenesis 43 C-terminal homolog
Synonyms: C130090K23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231293
Homologene: 5474
Cyp4f39
Name: cytochrome P450, family 4, subfamily f, polypeptide 39
Synonyms: 4732474A20Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320997
VEGA: 17
Homologene: 69814
Fam171a1
Name: family with sequence similarity 171, member A1
Synonyms: 9630050M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269233
Homologene: 19521
Zdhhc14
Name: zinc finger, DHHC domain containing 14
Synonyms: New1cp, B530001K09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224454
VEGA: 17
Homologene: 62301
Adgrb1
Name: adhesion G protein-coupled receptor B1
Synonyms: Bai1, B830018M07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 107831
HGNC: HGNC:943
Homologene: 1287
Usp43
Name: ubiquitin specific peptidase 43
Synonyms: C630032K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216835
Homologene: 129879
Mterf1a
Name: mitochondrial transcription termination factor 1a
Synonyms: Mterf1, Mterf, 9230106K09Rik, 4931431L11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545725
Homologene: 5073
Vmn2r16
Name: vomeronasal 2, receptor 16
Synonyms: EG384220
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384220
Homologene: 104825
Igfbp1
Name: insulin-like growth factor binding protein 1
Synonyms: IGFBP-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16006
HGNC: HGNC:5469
Homologene: 498
Cyp2c55
Name: cytochrome P450, family 2, subfamily c, polypeptide 55
Synonyms: 2010318C06Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72082
HGNC: HGNC:2620
Homologene: 133567
Tekt3
Name: tektin 3
Synonyms: 4933407G07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71062
Homologene: 12896
Coro6
Name: coronin 6
Synonyms: clipin E
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216961
Homologene: 104099
Phactr2
Name: phosphatase and actin regulator 2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215789
Homologene: 8816
Or8k35
Name: olfactory receptor family 8 subfamily K member 35
Synonyms: MOR192-4_p, GA_x6K02T2Q125-48079993-48079157, Olfr1082
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404473
Homologene: 104285
Zeb2
Name: zinc finger E-box binding homeobox 2
Synonyms: D130016B08Rik, SIP1, Zfx1b, 9130203F04Rik, Zfhx1b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24136
Homologene: 8868
Dbx2
Name: developing brain homeobox 2
Synonyms: 9430056A22Rik, LOC383001
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223843
Homologene: 54981
Chrng
Name: cholinergic receptor, nicotinic, gamma polypeptide
Synonyms: Acrg, Achr-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11449
HGNC: HGNC:1967
Homologene: 3810
Scarf2
Name: scavenger receptor class F, member 2
Synonyms: SREC-II, Srec2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224024
VEGA: 16
Homologene: 17817
Calcoco2
Name: calcium binding and coiled-coil domain 2
Synonyms: Ndp52, 2410154J16Rik, Ndp52l1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76815
Psg25
Name: pregnancy-specific beta-1-glycoprotein 25
Synonyms: cea13
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 114868
HGNC: HGNC:1819
Homologene: 110989
Hemgn
Name: hemogen
Synonyms: EDAG, 4921524M03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 93966
Homologene: 14223
Mettl17
Name: methyltransferase like 17
Synonyms: D14Ertd209e, 2310032K15Rik, Mett11d1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52535
Homologene: 11226
Stx17
Name: syntaxin 17
Synonyms: 9030425C21Rik, 6330411F21Rik, 4833418L03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67727
Homologene: 9917
Ccnl1
Name: cyclin L1
Synonyms: 2610030E23Rik, ania-6a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56706
Homologene: 10541
Or14j6
Name: olfactory receptor family 14 subfamily J member 6
Synonyms: Olfr127, MOR218-7, GA_x6K02T2PSCP-2354126-2355093
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258374
Homologene: 134080
Lbx1
Name: ladybird homeobox 1
Synonyms: Lbx1h
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16814
Homologene: 4784
Pstpip2
Name: proline-serine-threonine phosphatase-interacting protein 2
Synonyms: cmo
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 19201
VEGA: 18
HGNC: HGNC:9581
Homologene: 69150
Msmb
Name: beta-microseminoprotein
Synonyms: PSP94, beta-inhibin, prostatic inhibin protein, PIP, beta-MSP
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17695
HGNC: HGNC:7372
Homologene: 1832
Spag6
Name: sperm associated antigen 6
Synonyms: BC061194, Spag6l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381350
Homologene: 133723
Krtap28-10
Name: keratin associated protein 28-10
Synonyms: 4733401N17Rik
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 82,288,109 bp
  • G to A, chromosome 1 at 82,669,762 bp
  • T to C, chromosome 1 at 83,042,087 bp
  • T to C, chromosome 1 at 87,207,497 bp
  • G to T, chromosome 1 at 120,603,000 bp
  • A to G, chromosome 2 at 3,225,903 bp
  • T to C, chromosome 2 at 5,795,424 bp
  • C to T, chromosome 2 at 18,734,117 bp
  • A to G, chromosome 2 at 31,520,395 bp
  • T to A, chromosome 2 at 44,996,127 bp
  • T to C, chromosome 2 at 58,829,820 bp
  • C to A, chromosome 2 at 76,730,320 bp
  • C to A, chromosome 2 at 86,594,400 bp
  • G to A, chromosome 2 at 161,021,069 bp
  • A to G, chromosome 2 at 163,080,733 bp
  • T to C, chromosome 3 at 59,071,882 bp
  • A to T, chromosome 3 at 65,946,848 bp
  • C to T, chromosome 3 at 96,715,201 bp
  • T to A, chromosome 3 at 121,729,411 bp
  • A to T, chromosome 4 at 43,538,281 bp
  • A to T, chromosome 4 at 46,396,682 bp
  • T to A, chromosome 4 at 48,183,444 bp
  • T to C, chromosome 4 at 138,581,219 bp
  • G to C, chromosome 4 at 144,068,482 bp
  • A to G, chromosome 5 at 3,891,425 bp
  • A to T, chromosome 5 at 65,278,792 bp
  • G to A, chromosome 5 at 73,441,359 bp
  • T to C, chromosome 5 at 109,340,044 bp
  • A to T, chromosome 5 at 110,101,975 bp
  • T to C, chromosome 5 at 115,482,645 bp
  • C to T, chromosome 6 at 15,415,094 bp
  • T to C, chromosome 6 at 83,977,053 bp
  • A to G, chromosome 6 at 103,708,861 bp
  • G to T, chromosome 7 at 18,529,594 bp
  • G to T, chromosome 7 at 99,268,985 bp
  • A to T, chromosome 8 at 3,161,358 bp
  • A to G, chromosome 8 at 12,880,003 bp
  • T to C, chromosome 9 at 31,327,397 bp
  • C to A, chromosome 9 at 53,570,640 bp
  • T to A, chromosome 9 at 95,991,193 bp
  • A to G, chromosome 10 at 13,253,732 bp
  • C to T, chromosome 10 at 62,315,515 bp
  • T to A, chromosome 10 at 108,382,742 bp
  • T to A, chromosome 11 at 7,201,929 bp
  • T to A, chromosome 11 at 50,781,744 bp
  • T to C, chromosome 11 at 63,070,232 bp
  • C to A, chromosome 11 at 67,898,962 bp
  • C to A, chromosome 11 at 77,469,091 bp
  • GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,099,982 bp
  • T to A, chromosome 11 at 101,564,694 bp
  • T to G, chromosome 11 at 113,658,498 bp
  • A to T, chromosome 13 at 22,003,005 bp
  • C to T, chromosome 13 at 25,202,283 bp
  • T to C, chromosome 14 at 26,669,125 bp
  • T to A, chromosome 14 at 32,150,260 bp
  • T to C, chromosome 14 at 41,121,831 bp
  • A to G, chromosome 14 at 51,884,851 bp
  • A to G, chromosome 15 at 74,543,658 bp
  • G to A, chromosome 15 at 81,772,480 bp
  • G to A, chromosome 15 at 95,632,400 bp
  • T to C, chromosome 16 at 17,097,405 bp
  • G to T, chromosome 16 at 17,803,110 bp
  • A to T, chromosome 17 at 5,725,295 bp
  • T to C, chromosome 17 at 31,599,546 bp
  • A to G, chromosome 17 at 32,122,116 bp
  • A to G, chromosome 17 at 32,483,297 bp
  • T to C, chromosome 17 at 37,904,224 bp
  • T to A, chromosome 17 at 38,304,981 bp
  • A to G, chromosome 17 at 43,085,481 bp
  • T to C, chromosome 17 at 56,900,295 bp
  • T to C, chromosome 18 at 67,834,632 bp
  • A to G, chromosome 18 at 77,846,408 bp
  • A to G, chromosome 19 at 24,397,058 bp
  • A to G, chromosome 19 at 39,031,434 bp
  • T to G, chromosome 19 at 45,235,166 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8865 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068681-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.