Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8865Btlr/Mmmh
Stock Number:
068681-MU
Citation ID:
RRID:MMRRC_068681-MU
Other Names:
R8865 (G1)
Major Collection:

Strain Information

Pknox1
Name: Pbx/knotted 1 homeobox
Synonyms: PREP1, D17Wsu76e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18771
HGNC: HGNC:9022
Homologene: 3363
Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
En1
Name: engrailed 1
Synonyms: Mo-en.1, En-1, engrailed-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13798
HGNC: HGNC:3342
Homologene: 50663
Xrn1
Name: 5'-3' exoribonuclease 1
Synonyms: mXrn1, Dhm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 24127
Homologene: 5894
Mllt1
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 1
Synonyms: BAM11, LTG19, ENL
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64144
VEGA: 17
HGNC: HGNC:7134
Homologene: 4339
Ppil2
Name: peptidylprolyl isomerase (cyclophilin)-like 2
Synonyms: C130078A06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66053
HGNC: HGNC:9261
Homologene: 8643
Pip5k1b
Name: phosphatidylinositol-4-phosphate 5-kinase, type 1 beta
Synonyms: Pipk5b
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18719
HGNC: HGNC:8995
Homologene: 100644
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 82,288,109 bp
  • G to A, chromosome 1 at 82,669,762 bp
  • T to C, chromosome 1 at 83,042,087 bp
  • T to C, chromosome 1 at 87,207,497 bp
  • G to T, chromosome 1 at 120,603,000 bp
  • A to G, chromosome 2 at 3,225,903 bp
  • T to C, chromosome 2 at 5,795,424 bp
  • C to T, chromosome 2 at 18,734,117 bp
  • A to G, chromosome 2 at 31,520,395 bp
  • T to A, chromosome 2 at 44,996,127 bp
  • T to C, chromosome 2 at 58,829,820 bp
  • C to A, chromosome 2 at 76,730,320 bp
  • C to A, chromosome 2 at 86,594,400 bp
  • G to A, chromosome 2 at 161,021,069 bp
  • A to G, chromosome 2 at 163,080,733 bp
  • T to C, chromosome 3 at 59,071,882 bp
  • A to T, chromosome 3 at 65,946,848 bp
  • C to T, chromosome 3 at 96,715,201 bp
  • T to A, chromosome 3 at 121,729,411 bp
  • A to T, chromosome 4 at 43,538,281 bp
  • A to T, chromosome 4 at 46,396,682 bp
  • T to A, chromosome 4 at 48,183,444 bp
  • T to C, chromosome 4 at 138,581,219 bp
  • G to C, chromosome 4 at 144,068,482 bp
  • A to G, chromosome 5 at 3,891,425 bp
  • A to T, chromosome 5 at 65,278,792 bp
  • G to A, chromosome 5 at 73,441,359 bp
  • T to C, chromosome 5 at 109,340,044 bp
  • A to T, chromosome 5 at 110,101,975 bp
  • T to C, chromosome 5 at 115,482,645 bp
  • C to T, chromosome 6 at 15,415,094 bp
  • T to C, chromosome 6 at 83,977,053 bp
  • A to G, chromosome 6 at 103,708,861 bp
  • G to T, chromosome 7 at 18,529,594 bp
  • G to T, chromosome 7 at 99,268,985 bp
  • A to T, chromosome 8 at 3,161,358 bp
  • A to G, chromosome 8 at 12,880,003 bp
  • T to C, chromosome 9 at 31,327,397 bp
  • C to A, chromosome 9 at 53,570,640 bp
  • T to A, chromosome 9 at 95,991,193 bp
  • A to G, chromosome 10 at 13,253,732 bp
  • C to T, chromosome 10 at 62,315,515 bp
  • T to A, chromosome 10 at 108,382,742 bp
  • T to A, chromosome 11 at 7,201,929 bp
  • T to A, chromosome 11 at 50,781,744 bp
  • T to C, chromosome 11 at 63,070,232 bp
  • C to A, chromosome 11 at 67,898,962 bp
  • C to A, chromosome 11 at 77,469,091 bp
  • GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,099,982 bp
  • T to A, chromosome 11 at 101,564,694 bp
  • T to G, chromosome 11 at 113,658,498 bp
  • A to T, chromosome 13 at 22,003,005 bp
  • C to T, chromosome 13 at 25,202,283 bp
  • T to C, chromosome 14 at 26,669,125 bp
  • T to A, chromosome 14 at 32,150,260 bp
  • T to C, chromosome 14 at 41,121,831 bp
  • A to G, chromosome 14 at 51,884,851 bp
  • A to G, chromosome 15 at 74,543,658 bp
  • G to A, chromosome 15 at 81,772,480 bp
  • G to A, chromosome 15 at 95,632,400 bp
  • T to C, chromosome 16 at 17,097,405 bp
  • G to T, chromosome 16 at 17,803,110 bp
  • A to T, chromosome 17 at 5,725,295 bp
  • T to C, chromosome 17 at 31,599,546 bp
  • A to G, chromosome 17 at 32,122,116 bp
  • A to G, chromosome 17 at 32,483,297 bp
  • T to C, chromosome 17 at 37,904,224 bp
  • T to A, chromosome 17 at 38,304,981 bp
  • A to G, chromosome 17 at 43,085,481 bp
  • T to C, chromosome 17 at 56,900,295 bp
  • T to C, chromosome 18 at 67,834,632 bp
  • A to G, chromosome 18 at 77,846,408 bp
  • A to G, chromosome 19 at 24,397,058 bp
  • A to G, chromosome 19 at 39,031,434 bp
  • T to G, chromosome 19 at 45,235,166 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8865 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068681-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.