Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8921Btlr/Mmmh
Stock Number:
068707-MU
Citation ID:
RRID:MMRRC_068707-MU
Other Names:
R8921 (G1)
Major Collection:

Strain Information

Prkar1a
Name: protein kinase, cAMP dependent regulatory, type I, alpha
Synonyms: Tse-1, Tse1, 1300018C22Rik, RIalpha
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19084
HGNC: HGNC:9388
Homologene: 37664
Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Galr2
Name: galanin receptor 2
Synonyms: mGalR, GalR2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14428
HGNC: HGNC:4133
Homologene: 2863
Rapgef6
Name: Rap guanine nucleotide exchange factor (GEF) 6
Synonyms: PDZ-GEF2, RA-GEF-2, Pdzgef2, C030018K18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192786
Homologene: 22968
Api5
Name: apoptosis inhibitor 5
Synonyms: AAC-11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11800
HGNC: HGNC:594
Homologene: 4809
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Cpne1
Name: copine I
Synonyms: 1810028N16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 266692
HGNC: HGNC:2314
Homologene: 36501
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 52,105,733 bp
  • A to G, chromosome 1 at 82,453,812 bp
  • T to C, chromosome 1 at 90,604,433 bp
  • A to G, chromosome 1 at 138,126,301 bp
  • C to G, chromosome 1 at 180,897,478 bp
  • C to T, chromosome 1 at 182,446,406 bp
  • A to G, chromosome 2 at 37,624,491 bp
  • A to G, chromosome 2 at 94,425,029 bp
  • T to C, chromosome 2 at 156,072,045 bp
  • T to A, chromosome 3 at 95,125,978 bp
  • A to T, chromosome 3 at 96,578,517 bp
  • T to C, chromosome 4 at 20,245,902 bp
  • T to A, chromosome 4 at 98,733,938 bp
  • A to G, chromosome 4 at 103,026,563 bp
  • T to C, chromosome 4 at 115,611,263 bp
  • C to A, chromosome 4 at 127,233,670 bp
  • T to G, chromosome 4 at 134,540,842 bp
  • T to C, chromosome 4 at 136,236,415 bp
  • C to T, chromosome 4 at 143,792,752 bp
  • A to G, chromosome 4 at 150,612,014 bp
  • T to C, chromosome 5 at 20,803,277 bp
  • A to T, chromosome 5 at 120,851,493 bp
  • A to G, chromosome 5 at 123,286,418 bp
  • A to T, chromosome 5 at 145,005,030 bp
  • A to G, chromosome 6 at 18,434,878 bp
  • T to C, chromosome 6 at 23,302,301 bp
  • A to T, chromosome 6 at 34,312,704 bp
  • T to A, chromosome 6 at 108,378,198 bp
  • C to T, chromosome 6 at 116,661,936 bp
  • G to A, chromosome 7 at 29,001,627 bp
  • G to A, chromosome 7 at 42,613,151 bp
  • C to A, chromosome 7 at 63,919,979 bp
  • T to C, chromosome 7 at 101,823,386 bp
  • G to T, chromosome 7 at 102,421,390 bp
  • T to C, chromosome 7 at 103,155,453 bp
  • A to G, chromosome 7 at 103,517,823 bp
  • G to A, chromosome 7 at 104,058,876 bp
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp
  • T to A, chromosome 8 at 40,754,673 bp
  • T to C, chromosome 8 at 72,488,144 bp
  • A to G, chromosome 9 at 14,357,646 bp
  • T to A, chromosome 9 at 39,669,441 bp
  • T to C, chromosome 9 at 67,266,823 bp
  • C to T, chromosome 10 at 60,305,129 bp
  • T to C, chromosome 10 at 81,348,987 bp
  • T to A, chromosome 11 at 3,894,933 bp
  • C to A, chromosome 11 at 43,705,517 bp
  • T to C, chromosome 11 at 54,679,239 bp
  • T to C, chromosome 11 at 65,911,921 bp
  • T to A, chromosome 11 at 69,984,485 bp
  • C to A, chromosome 11 at 98,973,626 bp
  • T to C, chromosome 11 at 103,197,141 bp
  • T to A, chromosome 11 at 106,312,806 bp
  • C to A, chromosome 11 at 109,665,918 bp
  • T to A, chromosome 11 at 116,283,147 bp
  • T to A, chromosome 12 at 8,938,139 bp
  • T to A, chromosome 12 at 13,413,589 bp
  • C to T, chromosome 12 at 55,490,555 bp
  • T to A, chromosome 12 at 84,348,282 bp
  • T to C, chromosome 12 at 88,177,182 bp
  • G to A, chromosome 13 at 3,933,428 bp
  • T to C, chromosome 13 at 13,359,406 bp
  • T to C, chromosome 13 at 65,296,230 bp
  • C to T, chromosome 13 at 70,791,791 bp
  • T to C, chromosome 13 at 100,617,684 bp
  • T to C, chromosome 14 at 113,315,061 bp
  • T to C, chromosome 15 at 79,828,962 bp
  • T to C, chromosome 15 at 90,971,727 bp
  • T to C, chromosome 16 at 17,307,740 bp
  • C to T, chromosome 16 at 29,454,774 bp
  • A to G, chromosome 16 at 63,652,475 bp
  • T to G, chromosome 17 at 34,614,777 bp
  • A to G, chromosome 17 at 62,881,058 bp
  • T to A, chromosome 17 at 84,682,825 bp
  • T to C, chromosome 18 at 10,541,825 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8921 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068707-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.