Strain Name:
C57BL/6J-MtgxR8938Btlr/Mmmh
Stock Number:
068711-MU
Citation ID:
RRID:MMRRC_068711-MU
Other Names:
R8938 (G1)
Major Collection:

Strain Information

Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Abcc8
Name: ATP-binding cassette, sub-family C member 8
Synonyms: SUR1, D930031B21Rik, Sur
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Shroom3
Name: shroom family member 3
Synonyms: Shrm3, D5Ertd287e, Shrm
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27428
Homologene: 9263
Zfp609
Name: zinc finger protein 609
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214812
Homologene: 72220
Stam
Name: signal transducing adaptor molecule (SH3 domain and ITAM motif) 1
Synonyms: STAM1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20844
Homologene: 37788
Patz1
Name: POZ (BTB) and AT hook containing zinc finger 1
Synonyms: 8430401L15Rik, POZ-AT hook-zinc finger protein, Zfp278, MAZR
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56218
Homologene: 8636
Plcg2
Name: phospholipase C, gamma 2
Synonyms: PLCgamma2, Plcg-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234779
HGNC: HGNC:9066
Homologene: 55671
Cyp51
Name: cytochrome P450, family 51
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13121
HGNC: HGNC:2649
Homologene: 55488
Fcho1
Name: FCH domain only 1
Synonyms: 3322402E17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74015
Homologene: 22869
Cdhr1
Name: cadherin-related family member 1
Synonyms: Pcdh21, Prcad
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 170677
VEGA: 14
Homologene: 13215
Zfp451
Name: zinc finger protein 451
Synonyms: 4933435G09Rik, 4930515K21Rik, Kiaa0576-hp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98403
Homologene: 9188
Mrpl2
Name: mitochondrial ribosomal protein L2
Synonyms: CGI-22, Rpml14, MRP-L14
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27398
Homologene: 69198
Brip1
Name: BRCA1 interacting protein C-terminal helicase 1
Synonyms: 8030460J03Rik, BACH1, 3110009N10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237911
Homologene: 32766
Firrm
Name: FIGNL1 interacting regulator of recombination and mitosis
Synonyms: FLIP, BC055324
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381306
Homologene: 10058
Pcdhb18
Name: protocadherin beta 18
Synonyms: PcdhbR, Pcdhb9
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93889
Homologene: 137649
Agtr1a
Name: angiotensin II receptor, type 1a
Synonyms: Agt1ar, Agtr-1a, AT1a, 1810074K20Rik, Angtr-1a, AT1, Agtr1a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11607
HGNC: HGNC:336
Homologene: 3556
Lhx8
Name: LIM homeobox protein 8
Synonyms: L3, Lhx7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16875
Homologene: 62661
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: Ryr, calcium release channel isoform 1, skrr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
H2-K1
Name: histocompatibility 2, K1, K region
Synonyms: H-2K
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14972
Homologene: 128352
Rac2
Name: Rac family small GTPase 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19354
VEGA: 15
HGNC: HGNC:9802
Homologene: 55699
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, Dnhd3, Dnahc2, 2900022L05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Lama3
Name: laminin, alpha 3
Synonyms: nicein, 150kDa, [a]3B
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 16774
HGNC: HGNC:6483
Homologene: 18279
Mybpc3
Name: myosin binding protein C, cardiac
Synonyms: cardiac C-protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17868
HGNC: HGNC:7551
Homologene: 215
Vmn2r100
Name: vomeronasal 2, receptor 100
Synonyms: EG627537
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627537
Homologene: 129750
Acsm1
Name: acyl-CoA synthetase medium-chain family member 1
Synonyms: Macs, Bucs1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 117147
Homologene: 24930
Mfsd6
Name: major facilitator superfamily domain containing 6
Synonyms: MMR2, 2210010L05Rik, 9630025I22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98682
Homologene: 9784
Bbox1
Name: gamma-butyrobetaine hydroxylase 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170442
HGNC: HGNC:964
Homologene: 2967
Mmp12
Name: matrix metallopeptidase 12
Synonyms: macrophage elastase, MMP12, Mmel
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17381
HGNC: HGNC:7158
Homologene: 20547
Ahnak
Name: AHNAK nucleoprotein
Synonyms: 2310047C17Rik, 1110004P15Rik, DY6
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Rfx4
Name: regulatory factor X, 4 (influences HLA class II expression)
Synonyms: 4933412G19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71137
HGNC: HGNC:9985
Homologene: 31119
Wdr90
Name: WD repeat domain 90
Synonyms: 3230401M21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106618
Homologene: 27066
Xkr7
Name: X-linked Kx blood group related 7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228787
Homologene: 19390
Nol4l
Name: nucleolar protein 4-like
Synonyms: LOC381396, 8430427H17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329540
Homologene: 129589
Zfp974
Name: zinc finger protein 974
Synonyms: 1700049G17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73430
Cr2
Name: complement receptor 2
Synonyms: Cr-1, Cr1, CD35, CD21, Cr-2, C3DR
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12902
HGNC: HGNC:2336
Homologene: 55611
Pik3c2b
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: C330011J12Rik, PI3K-C2beta
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240752
HGNC: HGNC:8972
Homologene: 20582
Or8g36
Name: olfactory receptor family 8 subfamily G member 36
Synonyms: Olfr957, GA_x6K02T2PVTD-33208209-33207274, MOR171-12
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258740
VEGA: 9
2310002L09Rik
Name: RIKEN cDNA 2310002L09 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71886
Homologene: 36448
Rptn
Name: repetin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20129
Homologene: 84780
Klk1b3
Name: kallikrein 1-related peptidase b3
Synonyms: Ngfg, mGk-3, Ngfg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18050
Homologene: 68141
Gsg1l2
Name: GSG1-like 2
Synonyms: Gm12302
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544792
Homologene: 132038
Prp2
Name: proline rich protein 2
Synonyms: MP14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 83380
Mpst
Name: mercaptopyruvate sulfurtransferase
Synonyms: 3MST
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 246221
VEGA: 15
HGNC: HGNC:7223
Homologene: 31942
Pcdha3
Name: protocadherin alpha 3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 192163
HGNC: HGNC:8669
Homologene: 129613
Pcdhga6
Name: protocadherin gamma subfamily A, 6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93714
HGNC: HGNC:8704
Homologene: 129611
Pcdhga8
Name: protocadherin gamma subfamily A, 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93716
HGNC: HGNC:8706
Homologene: 57162
Ighv1-62-1
Name: immunoglobulin heavy variable 1-62-1
Synonyms: Gm9232
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 668544
Igkv4-57
Name: immunoglobulin kappa variable 4-57
Synonyms: LOC235952
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 235952
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 33,802,982 bp
  • A to T, chromosome 1 at 52,709,295 bp
  • A to T, chromosome 1 at 118,836,205 bp
  • T to A, chromosome 1 at 133,088,330 bp
  • C to T, chromosome 1 at 163,961,972 bp
  • T to C, chromosome 1 at 195,171,116 bp
  • T to C, chromosome 2 at 14,129,173 bp
  • T to C, chromosome 2 at 91,123,949 bp
  • T to A, chromosome 2 at 110,270,184 bp
  • T to C, chromosome 2 at 153,032,213 bp
  • T to C, chromosome 2 at 153,420,731 bp
  • A to T, chromosome 3 at 93,395,025 bp
  • T to C, chromosome 3 at 154,322,387 bp
  • A to G, chromosome 4 at 73,943,187 bp
  • T to C, chromosome 5 at 4,100,202 bp
  • T to C, chromosome 5 at 92,943,071 bp
  • T to A, chromosome 6 at 69,576,272 bp
  • C to A, chromosome 6 at 132,600,618 bp
  • A to T, chromosome 7 at 27,910,886 bp
  • C to T, chromosome 7 at 29,101,933 bp
  • G to T, chromosome 7 at 44,200,305 bp
  • G to T, chromosome 7 at 46,166,994 bp
  • T to C, chromosome 7 at 119,659,162 bp
  • T to G, chromosome 8 at 71,717,146 bp
  • T to C, chromosome 8 at 117,504,375 bp
  • GTAATAATAATAATAATAAT to GTAATAATAATAATAAT, chromosome 9 at 7,348,446 bp
  • A to T, chromosome 9 at 39,511,614 bp
  • C to T, chromosome 9 at 65,703,279 bp
  • T to A, chromosome 10 at 84,840,072 bp
  • C to T, chromosome 11 at 3,290,660 bp
  • A to G, chromosome 11 at 67,789,573 bp
  • A to T, chromosome 11 at 69,437,928 bp
  • T to C, chromosome 11 at 86,148,401 bp
  • C to T, chromosome 12 at 115,387,115 bp
  • T to A, chromosome 12 at 115,920,368 bp
  • T to C, chromosome 13 at 30,381,066 bp
  • T to A, chromosome 14 at 37,087,448 bp
  • A to T, chromosome 15 at 78,410,070 bp
  • A to G, chromosome 15 at 78,561,912 bp
  • A to G, chromosome 17 at 19,531,563 bp
  • G to A, chromosome 17 at 25,857,172 bp
  • T to C, chromosome 17 at 33,997,320 bp
  • T to A, chromosome 17 at 46,646,312 bp
  • T to C, chromosome 18 at 12,556,705 bp
  • A to G, chromosome 18 at 36,947,101 bp
  • G to T, chromosome 18 at 37,490,484 bp
  • A to T, chromosome 18 at 37,708,509 bp
  • T to A, chromosome 18 at 37,726,902 bp
  • T to C, chromosome 19 at 9,011,735 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8938 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068711-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.