Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8977Btlr/Mmmh
Stock Number:
068715-MU
Citation ID:
RRID:MMRRC_068715-MU
Other Names:
R8977 (G1)
Major Collection:

Strain Information

Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Nucb2
Name: nucleobindin 2
Synonyms: NEFA, Calnuc, nesfatin-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53322
HGNC: HGNC:8044
Homologene: 3676
Rgs11
Name: regulator of G-protein signaling 11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50782
HGNC: HGNC:9993
Homologene: 77719
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Map7
Name: microtubule-associated protein 7
Synonyms: E-MAP-115, mste, ste, mshi, Mtap7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17761
VEGA: 10
HGNC: HGNC:6869
Homologene: 20851
Cbfa2t2
Name: CBFA2/RUNX1 translocation partner 2
Synonyms: MTGR1, C330013D05Rik, Cbfa2t2h
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12396
HGNC: HGNC:1536
Homologene: 3733
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Dnmbp
Name: dynamin binding protein
Synonyms: 2410003M15Rik, Tuba, 2410003L07Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71972
Homologene: 9061
Ankrd13a
Name: ankyrin repeat domain 13a
Synonyms: 1100001D10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68420
Homologene: 23814
Pkm
Name: pyruvate kinase, muscle
Synonyms: Pk-3, Pk-2, Pk3, Pkm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18746
VEGA: 9
HGNC: HGNC:9021
Homologene: 37650
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lec1, Lphn2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99633
Homologene: 22712
Anapc1
Name: anaphase promoting complex subunit 1
Synonyms: tsg24, Apc1, 2610021O03Rik, Mcpr
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17222
Homologene: 7414
Resf1
Name: retroelement silencing factor 1
Synonyms: GET, 2810474O19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67246
Homologene: 19251
Rad51b
Name: RAD51 paralog B
Synonyms: mREC2, R51H2, Rad51b, Rad51l1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19363
VEGA: 12
HGNC: HGNC:9822
Homologene: 50190
Prpf8
Name: pre-mRNA processing factor 8
Synonyms: DBF3/PRP8, Prp8, D11Bwg0410e, Sfprp8l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192159
Homologene: 4706
Chmp7
Name: charged multivesicular body protein 7
Synonyms: 4930596K11Rik, 6330407G04Rik, CHMP family, member 7
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105513
VEGA: 14
Homologene: 14613
Riox2
Name: ribosomal oxygenase 2
Synonyms: 1810047J07Rik, 3830408E23Rik, 2410057H13Rik, Mina
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67014
Homologene: 12071
Smarce1
Name: SWI/SNF related BAF chromatin remodeling complex subunit E1
Synonyms: BAF57, 2810417B20Rik, 9030408N19Rik, 5830412H02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57376
Homologene: 37727
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Aars1
Name: alanyl-tRNA synthetase 1
Synonyms: Aars
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234734
HGNC: HGNC:20
Homologene: 1213
Ncam1
Name: neural cell adhesion molecule 1
Synonyms: CD56, NCAM-1, NCAM-120, NCAM-140, NCAM-180, E-NCAM, NCAM
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17967
HGNC: HGNC:7656
Homologene: 40754
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Adam30
Name: a disintegrin and metallopeptidase domain 30
Synonyms: 4933424D07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71078
HGNC: HGNC:208
Homologene: 11038
Cuzd1
Name: CUB and zona pellucida-like domains 1
Synonyms: UTCZP, UO-44, ERG-1, Itmap1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16433
Homologene: 7389
Gdpd5
Name: glycerophosphodiester phosphodiesterase domain containing 5
Synonyms: Gde2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233552
Homologene: 32741
Pamr1
Name: peptidase domain containing associated with muscle regeneration 1
Synonyms: RAMP, E430002G05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 210622
Homologene: 9134
Atp2b2
Name: ATPase, Ca++ transporting, plasma membrane 2
Synonyms: PMCA2, D6Abb2e, wms, jog, Tmy, Gena300
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11941
HGNC: HGNC:815
Homologene: 56150
Cfap46
Name: cilia and flagella associated protein 46
Synonyms: Ttc40, 9330101J02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212124
Trim55
Name: tripartite motif-containing 55
Synonyms: D830041C10Rik, Murf2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 381485
Homologene: 13205
Itga11
Name: integrin alpha 11
Synonyms: 4732459H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319480
HGNC: HGNC:6136
Homologene: 8151
Map3k5
Name: mitogen-activated protein kinase kinase kinase 5
Synonyms: ASK1, Mekk5, 7420452D20Rik, ASK
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 26408
HGNC: HGNC:6857
Homologene: 38114
Vmn2r116
Name: vomeronasal 2, receptor 116
Synonyms: EG619697, V2Rp5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 619697
Homologene: 86604
Or1p1c
Name: olfactory receptor family 1 subfamily P member 1C
Synonyms: GA_x6K02T2P1NL-4415162-4416133, MOR133-1, Olfr406-ps, Olfr406
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258181
HGNC: HGNC:8222
Scn2a
Name: sodium channel, voltage-gated, type II, alpha
Synonyms: Nav1.2, A230052E19Rik, Scn2a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110876
Homologene: 75001
Cd109
Name: CD109 antigen
Synonyms: Gov platelet alloantigens, 9930012E15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235505
Homologene: 25183
Mettl2
Name: methyltransferase 2, methylcytidine
Synonyms: C130031G21Rik, PSENIP1, D11Ertd768e, 2810438F06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52686
Homologene: 10174
Sfi1
Name: Sfi1 homolog, spindle assembly associated (yeast)
Synonyms: 2310047I15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78887
Homologene: 12707
Top2b
Name: topoisomerase (DNA) II beta
Synonyms: Top-2, D230016L12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21974
Homologene: 134711
Mdga2
Name: MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms: Mdga2, 9330209L04Rik, 6720489L24Rik, Mamdc1, Adp
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320772
Homologene: 45659
Slc6a19
Name: solute carrier family 6 (neurotransmitter transporter), member 19
Synonyms: B0AT1, 4632401C08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74338
Homologene: 52819
Slco1b2
Name: solute carrier organic anion transporter family, member 1b2
Synonyms: mlst-1, Slc21a6, Slc21a10, Oatp1b2, 7330442B20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28253
Homologene: 75119
Mmut
Name: methylmalonyl-Coenzyme A mutase
Synonyms: D230010K02Rik, Mut
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17850
VEGA: 17
HGNC: HGNC:7526
Homologene: 20097
Or8k38
Name: olfactory receptor family 8 subfamily K member 38
Synonyms: GA_x6K02T2Q125-48147264-48146323, MOR191-1, Olfr1085
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258583
Eml6
Name: echinoderm microtubule associated protein like 6
Synonyms: 2900083P10Rik, C230094A16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237711
Homologene: 104282
Extl1
Name: exostosin-like glycosyltransferase 1
Synonyms: D430033M16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56219
HGNC: HGNC:3515
Homologene: 3277
Slc34a1
Name: solute carrier family 34 (sodium phosphate), member 1
Synonyms: renal Na+/Pi transporter, Na/Pi cotransporter, Slc17a2, Npt2, NaPi-IIa
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20505
VEGA: 13
Homologene: 20663
Ccnj
Name: cyclin J
Synonyms: D430039C20Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240665
Homologene: 10413
Adam6b
Name: a disintegrin and metallopeptidase domain 6B
Synonyms: 4930523C11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238405
Homologene: 128362
Abcc10
Name: ATP-binding cassette, sub-family C member 10
Synonyms: Mrp7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224814
HGNC: HGNC:52
Homologene: 58616
Vmn2r109
Name: vomeronasal 2, receptor 109
Synonyms: EG627814
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627814
Homologene: 129678
Or1e19
Name: olfactory receptor family 1 subfamily E member 19
Synonyms: GA_x6K02T2P1NL-3586282-3585338, MOR135-2, Olfr378
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259026
Homologene: 74110
Or51i1
Name: olfactory receptor family 51 subfamily I member 1D
Synonyms: GA_x6K02T2PBJ9-6756759-6755815, MOR13-4, Olfr640
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258819
Homologene: 17404
Dpp4
Name: dipeptidylpeptidase 4
Synonyms: THAM, Dpp-4, Cd26
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13482
HGNC: HGNC:3009
Homologene: 3279
Ggcx
Name: gamma-glutamyl carboxylase
Synonyms: vitamin K-dependent carboxylase
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56316
HGNC: HGNC:4247
Homologene: 639
Stk32c
Name: serine/threonine kinase 32C
Synonyms: YANK3, Pkek
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57740
Homologene: 75157
Cfap210
Name: cilia and flagella associated protein 210
Synonyms: 4930525K21Rik, 4930578N16Rik, Ccdc173
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75051
Homologene: 18989
Pi15
Name: peptidase inhibitor 15
Synonyms: P24TI, P25TI, SugarCrisp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 94227
HGNC: HGNC:8946
Homologene: 22935
Rd3l
Name: retinal degeneration 3-like
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217874
Homologene: 19151
4930438A08Rik
Name: RIKEN cDNA 4930438A08 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 73988
Homologene: 104884
Tekt2
Name: tektin 2
Synonyms: tektin-t
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 24084
Homologene: 8043
Or2b7
Name: olfactory receptor family 2 subfamily B member 7
Synonyms: GA_x6K02T2QHY8-11688984-11689964, MOR256-36, MOR256-63, MOR256-36, Olfr1365, Olfr1535
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 404335
Homologene: 131356
Paqr9
Name: progestin and adipoQ receptor family member IX
Synonyms: 1700020G04Rik, C730029A08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75552
Homologene: 18882
Bhlhe41
Name: basic helix-loop-helix family, member e41
Synonyms: DEC2, Sharp1, Bhlhb3, 6430520M22Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 79362
Homologene: 137371
Tex38
Name: testis expressed 38
Synonyms: 4930544O15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75173
Homologene: 47752
Prdm6
Name: PR domain containing 6
Synonyms: LOC225518, PRISM
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225518
HGNC: HGNC:9350
Homologene: 79756
Sec11c
Name: SEC11 homolog C, signal peptidase complex subunit
Synonyms: 1810029G24Rik, Sec11l3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66286
Homologene: 8624
Or52n1
Name: olfactory receptor family 52 subfamily N member 1, pseudogene 1
Synonyms: GA_x6K02T2PBJ9-7361631-7360711, MOR34-10P, EG667918, Olfr664
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667918
Ccer2
Name: coiled-coil glutamate-rich protein 2
Synonyms: Gm6537
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100504112
Homologene: 85749
Igkv5-48
Name: immunoglobulin kappa variable 5-48
Synonyms: ENSMUSG00000029975, Gm10881
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 619846
Gm9195
Name: predicted gene 9195
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 675947
Homologene: 139067
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 17,619,902 bp
  • A to T, chromosome 1 at 34,247,783 bp
  • A to G, chromosome 2 at 62,374,403 bp
  • T to A, chromosome 2 at 65,763,670 bp
  • T to C, chromosome 2 at 69,787,299 bp
  • C to T, chromosome 2 at 86,658,128 bp
  • T to A, chromosome 2 at 102,611,618 bp
  • C to A, chromosome 2 at 128,641,402 bp
  • T to G, chromosome 2 at 154,500,490 bp
  • C to A, chromosome 3 at 19,659,177 bp
  • A to G, chromosome 3 at 98,162,062 bp
  • G to T, chromosome 3 at 126,944,926 bp
  • T to C, chromosome 3 at 148,954,587 bp
  • A to G, chromosome 4 at 115,780,595 bp
  • T to C, chromosome 4 at 126,323,473 bp
  • T to C, chromosome 4 at 134,359,124 bp
  • T to A, chromosome 4 at 143,397,391 bp
  • A to T, chromosome 5 at 114,795,745 bp
  • G to C, chromosome 6 at 69,726,632 bp
  • T to C, chromosome 6 at 72,429,282 bp
  • T to C, chromosome 6 at 113,773,364 bp
  • A to T, chromosome 6 at 141,683,254 bp
  • C to A, chromosome 6 at 145,863,370 bp
  • T to A, chromosome 6 at 149,328,408 bp
  • G to A, chromosome 7 at 28,756,688 bp
  • A to T, chromosome 7 at 96,811,970 bp
  • A to G, chromosome 7 at 99,453,850 bp
  • A to T, chromosome 7 at 104,021,555 bp
  • A to T, chromosome 7 at 104,734,041 bp
  • C to A, chromosome 7 at 116,528,828 bp
  • A to G, chromosome 7 at 131,322,025 bp
  • A to T, chromosome 7 at 139,125,245 bp
  • G to T, chromosome 7 at 139,679,933 bp
  • G to A, chromosome 8 at 111,040,217 bp
  • G to T, chromosome 9 at 49,507,525 bp
  • T to A, chromosome 9 at 59,671,640 bp
  • T to C, chromosome 9 at 62,755,640 bp
  • G to A, chromosome 9 at 78,707,528 bp
  • A to T, chromosome 9 at 95,560,835 bp
  • T to A, chromosome 10 at 20,079,254 bp
  • T to A, chromosome 10 at 20,269,590 bp
  • ACA to ACATCTTCCCAAAGCCAGTCA, chromosome 11 at 3,153,382 bp
  • A to G, chromosome 11 at 29,784,182 bp
  • A to G, chromosome 11 at 58,293,884 bp
  • A to G, chromosome 11 at 73,425,825 bp
  • A to T, chromosome 11 at 74,269,478 bp
  • A to G, chromosome 11 at 75,496,044 bp
  • A to G, chromosome 11 at 99,219,685 bp
  • T to C, chromosome 11 at 105,128,965 bp
  • T to C, chromosome 12 at 8,015,990 bp
  • A to T, chromosome 12 at 66,797,635 bp
  • T to A, chromosome 12 at 79,657,888 bp
  • T to A, chromosome 12 at 111,980,159 bp
  • A to T, chromosome 12 at 113,490,376 bp
  • T to A, chromosome 13 at 21,555,846 bp
  • T to C, chromosome 13 at 55,409,002 bp
  • T to C, chromosome 13 at 73,682,150 bp
  • T to A, chromosome 14 at 16,393,239 bp
  • A to G, chromosome 14 at 69,721,235 bp
  • A to G, chromosome 14 at 72,453,898 bp
  • A to G, chromosome 15 at 6,783,085 bp
  • A to G, chromosome 16 at 59,491,832 bp
  • A to T, chromosome 17 at 20,554,269 bp
  • C to T, chromosome 17 at 23,386,942 bp
  • T to C, chromosome 17 at 26,208,259 bp
  • G to T, chromosome 17 at 40,938,590 bp
  • C to A, chromosome 17 at 46,313,667 bp
  • A to T, chromosome 18 at 53,568,301 bp
  • A to G, chromosome 18 at 65,812,747 bp
  • T to C, chromosome 19 at 40,844,939 bp
  • A to T, chromosome 19 at 43,852,312 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8977 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068715-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.