Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8977Btlr/Mmmh
Stock Number:
068715-MU
Citation ID:
RRID:MMRRC_068715-MU
Other Names:
R8977 (G1)
Major Collection:

Strain Information

Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Nucb2
Name: nucleobindin 2
Synonyms: NEFA, Calnuc, nesfatin-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53322
HGNC: HGNC:8044
Homologene: 3676
Rgs11
Name: regulator of G-protein signaling 11
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 50782
HGNC: HGNC:9993
Homologene: 77719
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Map7
Name: microtubule-associated protein 7
Synonyms: E-MAP-115, mste, ste, mshi, Mtap7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17761
VEGA: 10
HGNC: HGNC:6869
Homologene: 20851
Cbfa2t2
Name: CBFA2/RUNX1 translocation partner 2
Synonyms: MTGR1, C330013D05Rik, Cbfa2t2h
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12396
HGNC: HGNC:1536
Homologene: 3733
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 17,619,902 bp
  • A to T, chromosome 1 at 34,247,783 bp
  • A to G, chromosome 2 at 62,374,403 bp
  • T to A, chromosome 2 at 65,763,670 bp
  • T to C, chromosome 2 at 69,787,299 bp
  • C to T, chromosome 2 at 86,658,128 bp
  • T to A, chromosome 2 at 102,611,618 bp
  • C to A, chromosome 2 at 128,641,402 bp
  • T to G, chromosome 2 at 154,500,490 bp
  • C to A, chromosome 3 at 19,659,177 bp
  • A to G, chromosome 3 at 98,162,062 bp
  • G to T, chromosome 3 at 126,944,926 bp
  • T to C, chromosome 3 at 148,954,587 bp
  • A to G, chromosome 4 at 115,780,595 bp
  • T to C, chromosome 4 at 126,323,473 bp
  • T to C, chromosome 4 at 134,359,124 bp
  • T to A, chromosome 4 at 143,397,391 bp
  • A to T, chromosome 5 at 114,795,745 bp
  • G to C, chromosome 6 at 69,726,632 bp
  • T to C, chromosome 6 at 72,429,282 bp
  • T to C, chromosome 6 at 113,773,364 bp
  • A to T, chromosome 6 at 141,683,254 bp
  • C to A, chromosome 6 at 145,863,370 bp
  • T to A, chromosome 6 at 149,328,408 bp
  • G to A, chromosome 7 at 28,756,688 bp
  • A to T, chromosome 7 at 96,811,970 bp
  • A to G, chromosome 7 at 99,453,850 bp
  • A to T, chromosome 7 at 104,021,555 bp
  • A to T, chromosome 7 at 104,734,041 bp
  • C to A, chromosome 7 at 116,528,828 bp
  • A to G, chromosome 7 at 131,322,025 bp
  • A to T, chromosome 7 at 139,125,245 bp
  • G to T, chromosome 7 at 139,679,933 bp
  • G to A, chromosome 8 at 111,040,217 bp
  • G to T, chromosome 9 at 49,507,525 bp
  • T to A, chromosome 9 at 59,671,640 bp
  • T to C, chromosome 9 at 62,755,640 bp
  • G to A, chromosome 9 at 78,707,528 bp
  • A to T, chromosome 9 at 95,560,835 bp
  • T to A, chromosome 10 at 20,079,254 bp
  • T to A, chromosome 10 at 20,269,590 bp
  • ACA to ACATCTTCCCAAAGCCAGTCA, chromosome 11 at 3,153,382 bp
  • A to G, chromosome 11 at 29,784,182 bp
  • A to G, chromosome 11 at 58,293,884 bp
  • A to G, chromosome 11 at 73,425,825 bp
  • A to T, chromosome 11 at 74,269,478 bp
  • A to G, chromosome 11 at 75,496,044 bp
  • A to G, chromosome 11 at 99,219,685 bp
  • T to C, chromosome 11 at 105,128,965 bp
  • T to C, chromosome 12 at 8,015,990 bp
  • A to T, chromosome 12 at 66,797,635 bp
  • T to A, chromosome 12 at 79,657,888 bp
  • T to A, chromosome 12 at 111,980,159 bp
  • A to T, chromosome 12 at 113,490,376 bp
  • T to A, chromosome 13 at 21,555,846 bp
  • T to C, chromosome 13 at 55,409,002 bp
  • T to C, chromosome 13 at 73,682,150 bp
  • T to A, chromosome 14 at 16,393,239 bp
  • A to G, chromosome 14 at 69,721,235 bp
  • A to G, chromosome 14 at 72,453,898 bp
  • A to G, chromosome 15 at 6,783,085 bp
  • A to G, chromosome 16 at 59,491,832 bp
  • A to T, chromosome 17 at 20,554,269 bp
  • C to T, chromosome 17 at 23,386,942 bp
  • T to C, chromosome 17 at 26,208,259 bp
  • G to T, chromosome 17 at 40,938,590 bp
  • C to A, chromosome 17 at 46,313,667 bp
  • A to T, chromosome 18 at 53,568,301 bp
  • A to G, chromosome 18 at 65,812,747 bp
  • T to C, chromosome 19 at 40,844,939 bp
  • A to T, chromosome 19 at 43,852,312 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8977 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068715-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.