Strain Name:
C57BL/6J-MtgxR8828Btlr/Mmmh
Stock Number:
068730-MU
Citation ID:
RRID:MMRRC_068730-MU
Other Names:
R8828 (G1)
Major Collection:

Strain Information

Ide
Name: insulin degrading enzyme
Synonyms: 1300012G03Rik, 4833415K22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15925
HGNC: HGNC:5381
Homologene: 3645
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Aclp7, trabeculin alpha, Acf7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Zmynd8
Name: zinc finger, MYND-type containing 8
Synonyms: RACK7, 3632413B07Rik, ZMYND8, Prkcbp1, 2010005I16Rik, 1110013E22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228880
HGNC: HGNC:9397
Homologene: 32679
Ppp1r13b
Name: protein phosphatase 1, regulatory subunit 13B
Synonyms: ASPP1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 21981
VEGA: 12
Homologene: 9090
Dclre1c
Name: DNA cross-link repair 1C
Synonyms: 9930121L06Rik, Artemis, Art
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227525
Homologene: 32547
Arl8b
Name: ADP-ribosylation factor-like 8B
Synonyms: Arl10c, 2610313E07Rik, 3100002J04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67166
Homologene: 10056
Psmb2
Name: proteasome (prosome, macropain) subunit, beta type 2
Synonyms: D4Wsu33e, HC7-I
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26445
HGNC: HGNC:9539
Homologene: 2088
Dock6
Name: dedicator of cytokinesis 6
Synonyms: C330023D02Rik, 2410095B20Rik, 4931431C02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319899
VEGA: 9
Homologene: 83291
Nf1
Name: neurofibromin 1
Synonyms: Dsk9, neurofibromin, Nf-1, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Yeats2
Name: YEATS domain containing 2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208146
VEGA: 16
Homologene: 9967
Uaca
Name: uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms: 2700059D02Rik, nucling
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72565
VEGA: 9
Homologene: 74297
Hars1
Name: histidyl-tRNA synthetase 1
Synonyms: MMHRS, Hars
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15115
VEGA: 18
HGNC: HGNC:4816
Homologene: 1592
Bptf
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207165
HGNC: HGNC:3581
Homologene: 114397
Npepps
Name: aminopeptidase puromycin sensitive
Synonyms: Psa, MP100
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19155
HGNC: HGNC:7900
Homologene: 36199
Immt
Name: inner membrane protein, mitochondrial
Synonyms: D830041H16Rik, Micos60, mitofilin, HMP, 1700082C19Rik, P87, P87/89, P89
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76614
HGNC: HGNC:6047
Homologene: 38234
Ppm1g
Name: protein phosphatase 1G (formerly 2C), magnesium-dependent, gamma isoform
Synonyms: Fin13
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14208
HGNC: HGNC:9278
Homologene: 31106
Chd8
Name: chromodomain helicase DNA binding protein 8
Synonyms: Duplin, 5830451P18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67772
Homologene: 72405
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: Solo, 6720464I07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Capns1
Name: calpain, small subunit 1
Synonyms: D7Ertd146e, Capa-4, Capn4, Capa4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12336
HGNC: HGNC:1481
Homologene: 1327
Iqcd
Name: IQ motif containing D
Synonyms: 4933433C09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75732
Homologene: 49921
Ctsl
Name: cathepsin L
Synonyms: MEP, 1190035F06Rik, major excreted protein, Cat L
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13039
VEGA: 13
Homologene: 76699
Prim1
Name: DNA primase, p49 subunit
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19075
HGNC: HGNC:9369
Homologene: 730
Cct5
Name: chaperonin containing TCP1 subunit 5
Synonyms: TCPE, Ccte
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12465
HGNC: HGNC:1618
Homologene: 6287
Fam72a
Name: family with sequence similarity 72, member A
Synonyms: P17, 2700049P18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108900
Homologene: 82352
Sdccag8
Name: serologically defined colon cancer antigen 8
Synonyms: CCCAP, 5730470G24Rik, 2700048G21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76816
Homologene: 4839
Trim33
Name: tripartite motif-containing 33
Synonyms: Tif1g, ectodermin, Ecto, 8030451N04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 94093
Homologene: 9296
Grina
Name: glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)
Synonyms: Tmbim3, 1110025J15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66168
VEGA: 15
HGNC: HGNC:4589
Homologene: 41517
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Ttn
Name: titin
Synonyms: 2310074I15Rik, D330041I19Rik, 2310057K23Rik, connectin, 2310036G12Rik, shru, D830007G01Rik, L56, 1100001C23Rik, mdm
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Ptprq
Name: protein tyrosine phosphatase receptor type Q
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Myo3a
Name: myosin IIIA
Synonyms: 9030416P08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 667663
HGNC: HGNC:7601
Homologene: 49486
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Mi-2 alpha, 2600010P09Rik, Prp9-1, Prp7, Chd7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Dock10
Name: dedicator of cytokinesis 10
Synonyms: Jr5, ZIZ3, 9330153B10Rik, Zizimin3, A630054M16Rik, Jr4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210293
Homologene: 45952
Zfp804a
Name: zinc finger protein 804A
Synonyms: C630007C17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241514
Homologene: 18461
Lrguk
Name: leucine-rich repeats and guanylate kinase domain containing
Synonyms: 4921528H16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74354
Homologene: 34923
Grm3
Name: glutamate receptor, metabotropic 3
Synonyms: Gprc1c, 0710001G23Rik, mGlu3, mGluR3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108069
HGNC: HGNC:4595
Homologene: 651
Sema4f
Name: sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic domain
Synonyms: Sema W
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20355
Homologene: 3147
Vmn2r73
Name: vomeronasal 2, receptor 73
Synonyms: EG620928
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620928
Homologene: 115466
Zmynd15
Name: zinc finger, MYND-type containing 15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 574428
Homologene: 12995
Pcnx1
Name: pecanex 1
Synonyms: 3526401J03Rik, 2900024E21Rik, Pcnx
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 54604
VEGA: 12
Homologene: 40997
Or52p1
Name: olfactory receptor family 52 subfamily P member 1
Synonyms: Olfr656, MOR27-1, GA_x6K02T2PBJ9-7245486-7246451
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259078
Homologene: 128072
Zfp175
Name: zinc finger protein 175
Synonyms: Zfp658
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210104
Homologene: 134007
Asb2
Name: ankyrin repeat and SOCS box-containing 2
Synonyms: 1110008E15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 65256
Homologene: 69202
Lrfn2
Name: leucine rich repeat and fibronectin type III domain containing 2
Synonyms: 5730420O05Rik, SALM1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70530
Homologene: 19182
Or5v1b
Name: olfactory receptor family 5 subfamily V member 1B
Synonyms: MOR249-1P, GA_x6K02T2PSCP-1989071-1990024, Olfr111
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 545205
Homologene: 73968
Klk6
Name: kallikrein related-peptidase 6
Synonyms: Prss18, Bssp, protease M, neurosin, Klk29, Prss9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19144
HGNC: HGNC:6367
Homologene: 68279
Abi3bp
Name: ABI family member 3 binding protein
Synonyms: TARSH, D930038M13Rik, 5033411B22Rik, eratin
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320712
VEGA: 16
Homologene: 134172
Cd200
Name: CD200 molecule
Synonyms: MRC OX-2, Mox2, OX2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17470
HGNC: HGNC:7203
Homologene: 4344
Klhdc1
Name: kelch domain containing 1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 271005
Homologene: 18155
Dvl3
Name: dishevelled segment polarity protein 3
Synonyms: b2b2866Clo
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13544
HGNC: HGNC:3087
Homologene: 20928
Vav3
Name: vav 3 oncogene
Synonyms: Idd18.1, A530094I06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 57257
Homologene: 38143
Prl7c1
Name: prolactin family 7, subfamily c, member 1
Synonyms: Prlpo, 1600017N11Rik, PLP-O
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67505
Homologene: 137377
Scly
Name: selenocysteine lyase
Synonyms: Scly1, Scly2, Selenocysteine reductase, SCL, A930015N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 50880
Homologene: 9548
Lrwd1
Name: leucine-rich repeats and WD repeat domain containing 1
Synonyms: 1200011O22Rik, Orca
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71735
Homologene: 17678
Vmn1r229
Name: vomeronasal 1 receptor 229
Synonyms: V1re1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171224
Homologene: 74319
Nudt16l2
Name: nudix hydrolase 16 like 2
Synonyms: 1700080E11Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73532
Homologene: 87061
Zkscan14
Name: zinc finger with KRAB and SCAN domains 14
Synonyms: 2810437E14Rik, 2310046C23Rik, Zfp99
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67235
Homologene: 11342
Scgb2b20
Name: secretoglobin, family 2B, member 20
Synonyms: C2c, Abpd, Abpbg20
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 494519
Homologene: 83171
Prl4a1
Name: prolactin family 4, subfamily a, member 1
Synonyms: PLP-A, Prlpa
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19110
Homologene: 7900
Tmem262
Name: transmembrane protein 262
Synonyms: BC048609
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 433215
Homologene: 104835
Gnrh1
Name: gonadotropin releasing hormone 1
Synonyms: LHRH, LNRH
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14714
VEGA: 14
HGNC: HGNC:4419
Homologene: 641
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 80,543,417 bp
  • C to A, chromosome 1 at 91,317,108 bp
  • T to A, chromosome 1 at 131,530,723 bp
  • G to A, chromosome 1 at 176,955,907 bp
  • T to G, chromosome 2 at 3,443,677 bp
  • A to T, chromosome 2 at 22,241,053 bp
  • T to C, chromosome 2 at 52,194,426 bp
  • G to T, chromosome 2 at 76,711,612 bp
  • A to T, chromosome 2 at 76,942,430 bp
  • A to C, chromosome 2 at 82,259,115 bp
  • A to T, chromosome 2 at 165,812,546 bp
  • A to G, chromosome 3 at 103,329,076 bp
  • T to A, chromosome 3 at 109,647,735 bp
  • A to T, chromosome 4 at 123,408,411 bp
  • A to G, chromosome 4 at 126,709,537 bp
  • A to T, chromosome 5 at 9,504,725 bp
  • A to T, chromosome 5 at 31,208,424 bp
  • A to G, chromosome 5 at 120,600,167 bp
  • G to T, chromosome 5 at 136,135,933 bp
  • C to T, chromosome 5 at 145,201,565 bp
  • A to C, chromosome 6 at 34,103,637 bp
  • C to A, chromosome 6 at 71,852,778 bp
  • G to A, chromosome 6 at 82,917,892 bp
  • A to C, chromosome 6 at 82,917,893 bp
  • A to G, chromosome 6 at 108,815,289 bp
  • T to A, chromosome 7 at 30,190,538 bp
  • T to C, chromosome 7 at 33,366,264 bp
  • T to A, chromosome 7 at 43,572,816 bp
  • C to A, chromosome 7 at 43,828,637 bp
  • T to C, chromosome 7 at 43,828,638 bp
  • A to G, chromosome 7 at 85,871,971 bp
  • A to T, chromosome 7 at 104,618,279 bp
  • T to C, chromosome 8 at 15,998,794 bp
  • A to T, chromosome 9 at 21,846,501 bp
  • T to A, chromosome 9 at 60,871,570 bp
  • C to T, chromosome 9 at 105,144,449 bp
  • A to G, chromosome 10 at 107,646,652 bp
  • A to G, chromosome 10 at 128,023,892 bp
  • C to T, chromosome 11 at 69,356,271 bp
  • A to T, chromosome 11 at 70,464,191 bp
  • A to T, chromosome 11 at 79,395,853 bp
  • G to T, chromosome 11 at 97,240,997 bp
  • T to C, chromosome 11 at 107,055,010 bp
  • T to C, chromosome 12 at 69,252,034 bp
  • T to A, chromosome 12 at 81,995,823 bp
  • C to A, chromosome 12 at 103,338,198 bp
  • T to C, chromosome 12 at 111,833,547 bp
  • A to T, chromosome 13 at 27,773,871 bp
  • T to C, chromosome 13 at 28,023,324 bp
  • A to G, chromosome 13 at 64,366,500 bp
  • CAGGGTCTGCCCTCATGGTATTGTATTTCTCATAGCCTAAAAGAACAAGGG to C, chromosome 14 at 52,210,580 bp
  • T to A, chromosome 14 at 67,747,885 bp
  • C to A, chromosome 15 at 27,741,064 bp
  • T to C, chromosome 15 at 31,594,512 bp
  • T to A, chromosome 15 at 76,248,297 bp
  • A to T, chromosome 16 at 20,150,510 bp
  • T to A, chromosome 16 at 20,525,745 bp
  • G to A, chromosome 16 at 45,394,794 bp
  • A to T, chromosome 16 at 56,687,092 bp
  • T to A, chromosome 17 at 20,814,728 bp
  • A to G, chromosome 17 at 37,530,442 bp
  • A to T, chromosome 17 at 49,097,104 bp
  • C to A, chromosome 18 at 36,766,943 bp
  • C to T, chromosome 19 at 6,080,088 bp
  • T to A, chromosome 19 at 37,314,842 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8828 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068730-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.