Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8828Btlr/Mmmh
Stock Number:
068730-MU
Citation ID:
RRID:MMRRC_068730-MU
Other Names:
R8828 (G1)
Major Collection:

Strain Information

Ide
Name: insulin degrading enzyme
Synonyms: 1300012G03Rik, 4833415K22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15925
HGNC: HGNC:5381
Homologene: 3645
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Zmynd8
Name: zinc finger, MYND-type containing 8
Synonyms: 1110013E22Rik, 2010005I16Rik, ZMYND8, RACK7, 3632413B07Rik, Prkcbp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228880
HGNC: HGNC:9397
Homologene: 32679
Ppp1r13b
Name: protein phosphatase 1, regulatory subunit 13B
Synonyms: ASPP1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 21981
VEGA: 12
Homologene: 9090
Dclre1c
Name: DNA cross-link repair 1C
Synonyms: 9930121L06Rik, Artemis, Art
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227525
Homologene: 32547
Arl8b
Name: ADP-ribosylation factor-like 8B
Synonyms: 3100002J04Rik, 2610313E07Rik, Arl10c
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67166
Homologene: 10056
Psmb2
Name: proteasome (prosome, macropain) subunit, beta type 2
Synonyms: HC7-I, D4Wsu33e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 26445
HGNC: HGNC:9539
Homologene: 2088
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 80,543,417 bp
  • C to A, chromosome 1 at 91,317,108 bp
  • T to A, chromosome 1 at 131,530,723 bp
  • G to A, chromosome 1 at 176,955,907 bp
  • T to G, chromosome 2 at 3,443,677 bp
  • A to T, chromosome 2 at 22,241,053 bp
  • T to C, chromosome 2 at 52,194,426 bp
  • G to T, chromosome 2 at 76,711,612 bp
  • A to T, chromosome 2 at 76,942,430 bp
  • A to C, chromosome 2 at 82,259,115 bp
  • A to T, chromosome 2 at 165,812,546 bp
  • A to G, chromosome 3 at 103,329,076 bp
  • T to A, chromosome 3 at 109,647,735 bp
  • A to T, chromosome 4 at 123,408,411 bp
  • A to G, chromosome 4 at 126,709,537 bp
  • A to T, chromosome 5 at 9,504,725 bp
  • A to T, chromosome 5 at 31,208,424 bp
  • A to G, chromosome 5 at 120,600,167 bp
  • G to T, chromosome 5 at 136,135,933 bp
  • C to T, chromosome 5 at 145,201,565 bp
  • A to C, chromosome 6 at 34,103,637 bp
  • C to A, chromosome 6 at 71,852,778 bp
  • G to A, chromosome 6 at 82,917,892 bp
  • A to C, chromosome 6 at 82,917,893 bp
  • A to G, chromosome 6 at 108,815,289 bp
  • T to A, chromosome 7 at 30,190,538 bp
  • T to C, chromosome 7 at 33,366,264 bp
  • T to A, chromosome 7 at 43,572,816 bp
  • C to A, chromosome 7 at 43,828,637 bp
  • T to C, chromosome 7 at 43,828,638 bp
  • A to G, chromosome 7 at 85,871,971 bp
  • A to T, chromosome 7 at 104,618,279 bp
  • T to C, chromosome 8 at 15,998,794 bp
  • A to T, chromosome 9 at 21,846,501 bp
  • T to A, chromosome 9 at 60,871,570 bp
  • C to T, chromosome 9 at 105,144,449 bp
  • A to G, chromosome 10 at 107,646,652 bp
  • A to G, chromosome 10 at 128,023,892 bp
  • C to T, chromosome 11 at 69,356,271 bp
  • A to T, chromosome 11 at 70,464,191 bp
  • A to T, chromosome 11 at 79,395,853 bp
  • G to T, chromosome 11 at 97,240,997 bp
  • T to C, chromosome 11 at 107,055,010 bp
  • T to C, chromosome 12 at 69,252,034 bp
  • T to A, chromosome 12 at 81,995,823 bp
  • C to A, chromosome 12 at 103,338,198 bp
  • T to C, chromosome 12 at 111,833,547 bp
  • A to T, chromosome 13 at 27,773,871 bp
  • T to C, chromosome 13 at 28,023,324 bp
  • A to G, chromosome 13 at 64,366,500 bp
  • CAGGGTCTGCCCTCATGGTATTGTATTTCTCATAGCCTAAAAGAACAAGGG to C, chromosome 14 at 52,210,580 bp
  • T to A, chromosome 14 at 67,747,885 bp
  • C to A, chromosome 15 at 27,741,064 bp
  • T to C, chromosome 15 at 31,594,512 bp
  • T to A, chromosome 15 at 76,248,297 bp
  • A to T, chromosome 16 at 20,150,510 bp
  • T to A, chromosome 16 at 20,525,745 bp
  • G to A, chromosome 16 at 45,394,794 bp
  • A to T, chromosome 16 at 56,687,092 bp
  • T to A, chromosome 17 at 20,814,728 bp
  • A to G, chromosome 17 at 37,530,442 bp
  • A to T, chromosome 17 at 49,097,104 bp
  • C to A, chromosome 18 at 36,766,943 bp
  • C to T, chromosome 19 at 6,080,088 bp
  • T to A, chromosome 19 at 37,314,842 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8828 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068730-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.