Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8903Btlr/Mmmh
Stock Number:
068760-MU
Citation ID:
RRID:MMRRC_068760-MU
Other Names:
R8903 (G1)
Major Collection:

Strain Information

Pald1
Name: phosphatase domain containing, paladin 1
Synonyms: paladin, X99384
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27355
VEGA: 10
Homologene: 8453
Met
Name: met proto-oncogene
Synonyms: HGF receptor, c-Met, Par4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17295
HGNC: HGNC:7029
Homologene: 206
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Zbtb7c
Name: zinc finger and BTB domain containing 7C
Synonyms: B230208J24Rik, Zbtb36, Kr-pok
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 207259
VEGA: 18
Homologene: 17070
Ano6
Name: anoctamin 6
Synonyms: 2900059G15Rik, F730003B03Rik, Tmem16f
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105722
VEGA: 15
Homologene: 27888
Usp25
Name: ubiquitin specific peptidase 25
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 30940
VEGA: 16
Homologene: 8374
Wac
Name: WW domain containing adaptor with coiled-coil
Synonyms: Wwp4, 1110067P07Rik, A230035H12Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225131
Homologene: 41148
Cdkal1
Name: CDK5 regulatory subunit associated protein 1-like 1
Synonyms: 6620401C13Rik, 1190005B03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68916
Homologene: 9830
Tut4
Name: terminal uridylyl transferase 4
Synonyms: 6030404K05Rik, 9230115F04Rik, Tent3a, Zcchc11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230594
Homologene: 35279
Arfgef1
Name: ARF guanine nucleotide exchange factor 1
Synonyms: D730028O18Rik, ARFGEP1, P200, BIG1, D130059B05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211673
Homologene: 4687
Ttk
Name: Ttk protein kinase
Synonyms: Esk1, Mps1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22137
Homologene: 2489
Dennd10
Name: DENN domain containing 10
Synonyms: 1810055E12Rik, Fam45a
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67894
Homologene: 10217
Nif3l1
Name: Ngg1 interacting factor 3-like 1 (S. pombe)
Synonyms: 1110030G24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 65102
Homologene: 5881
Lrrfip1
Name: leucine rich repeat (in FLII) interacting protein 1
Synonyms: FLAP (FLI LRR associated protein), Fliiap1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16978
HGNC: HGNC:6702
Homologene: 48301
Mcpt1
Name: mast cell protease 1
Synonyms: Mcp-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17224
VEGA: 14
Homologene: 137209
Rnf14
Name: ring finger protein 14
Synonyms: Triad2, 2310075C09Rik, 2610005D23Rik, D18Ertd188e, D7Bwg0165e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 56736
VEGA: 18
Homologene: 129170
D6Wsu163e
Name: DNA segment, Chr 6, Wayne State University 163, expressed
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28040
HGNC: HGNC:1184
Homologene: 10685
Pisd
Name: phosphatidylserine decarboxylase
Synonyms: 9030221M09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320951
HGNC: HGNC:8999
Homologene: 81653
Rac3
Name: Rac family small GTPase 3
Synonyms: Rac1B
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170758
HGNC: HGNC:9803
Homologene: 68433
Magel2
Name: MAGE family member L2
Synonyms: NDNL1, Mage-l2, nM15, ns7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27385
HGNC: HGNC:6814
Homologene: 8460
Susd1
Name: sushi domain containing 1
Synonyms: Gm12528
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 634731
Homologene: 11204
Snorc
Name: secondary ossification center associated regulator of chondrocyte maturation
Synonyms: Snorc, 3110079O15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73234
Homologene: 19210
Cnbp
Name: cellular nucleic acid binding protein
Synonyms: Znf9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12785
Homologene: 2567
Pum3
Name: pumilio RNA-binding family member 3
Synonyms: 1110069H02Rik, D19Bwg1357e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52874
VEGA: 19
Homologene: 5762
Pard6g
Name: par-6 family cell polarity regulator gamma
Synonyms: 2410049N21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93737
VEGA: 18
Homologene: 36487
Gsk3a
Name: glycogen synthase kinase 3 alpha
Synonyms: 2700086H06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 606496
HGNC: HGNC:4616
Homologene: 88581
Nbl1
Name: NBL1, DAN family BMP antagonist
Synonyms: NO3, D4H1S1733E, Dana, DAN
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17965
Homologene: 3924
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Abca3
Name: ATP-binding cassette, sub-family A member 3
Synonyms: ABC-C, Abc3, 1810036E22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27410
HGNC: HGNC:33
Homologene: 37437
Stxbp4
Name: syntaxin binding protein 4
Synonyms: Synip, 6030470M02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20913
Homologene: 7963
Calcrl
Name: calcitonin receptor-like
Synonyms: CRLR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 54598
Homologene: 21179
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Gm10800
Name: predicted gene 10800
Type: Gene
Species: Mouse
Chromosome: 2
Wdr53
Name: WD repeat domain 53
Synonyms: 1500002B03Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68980
Homologene: 15591
Coq2
Name: coenzyme Q2 4-hydroxybenzoate polyprenyltransferase
Synonyms: 2310002F18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71883
Homologene: 69192
Psd3
Name: pleckstrin and Sec7 domain containing 3
Synonyms: 4931420C21Rik, EFA6D
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234353
Homologene: 87257
Myt1l
Name: myelin transcription factor 1-like
Synonyms: Png-1, Nztf1, Pmng1, C630034G21Rik, 2900093J19Rik, 2900046C06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17933
VEGA: 12
HGNC: HGNC:7623
Homologene: 7435
Nubpl
Name: nucleotide binding protein-like
Synonyms: 2410170E07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76826
Homologene: 11854
Slc7a14
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241919
Homologene: 76320
Pxdn
Name: peroxidasin
Synonyms: 2310075M15Rik, VPO1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69675
Homologene: 33907
Vmn2r80
Name: vomeronasal 2, receptor 80
Synonyms: EG624765
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624765
Homologene: 83483
Or56a3
Name: olfactory receptor family 56 subfamily A member 3
Synonyms: GA_x6K02T2PBJ9-7714499-7715446, MOR40-2, Olfr679
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259046
Homologene: 81538
Il1rl2
Name: interleukin 1 receptor-like 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107527
HGNC: HGNC:5999
Homologene: 2860
Prrt3
Name: proline-rich transmembrane protein 3
Synonyms: B230206N24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 210673
Homologene: 52099
Abca14
Name: ATP-binding cassette, sub-family A member 14
Synonyms: 1700110B15Rik, 4930539G24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67928
Homologene: 86128
Fes
Name: feline sarcoma oncogene
Synonyms: c-fes
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14159
HGNC: HGNC:3657
Homologene: 37563
Tecpr1
Name: tectonin beta-propeller repeat containing 1
Synonyms: 2210010N04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70381
Homologene: 9120
Grk3
Name: G protein-coupled receptor kinase 3
Synonyms: beta ARK2, Bark-2, Adrbk-2, 4833444A01Rik, Adrbk2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320129
HGNC: HGNC:290
Homologene: 21072
Clcnkb
Name: chloride channel, voltage-sensitive Kb
Synonyms: Clcnk1l, Clck2, ClC-K2, Clcnk2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56365
Homologene: 107317
Krtap16-1
Name: keratin associated protein 16-1
Synonyms: AI450886
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 100504183
Homologene: 99988
P2rx1
Name: purinergic receptor P2X, ligand-gated ion channel, 1
Synonyms: P2x, RP-2, P2X1 receptor, Pdcd3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18436
HGNC: HGNC:8533
Homologene: 1921
Gss
Name: glutathione synthetase
Synonyms: GS-A/GS-B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14854
HGNC: HGNC:4624
Homologene: 148
Tor2a
Name: torsin family 2, member A
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 30933
Homologene: 25260
Slc5a5
Name: solute carrier family 5 (sodium iodide symporter), member 5
Synonyms: NIS
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 114479
Homologene: 37311
Ano8
Name: anoctamin 8
Synonyms: Tmem16h
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382014
Homologene: 124473
Nid1
Name: nidogen 1
Synonyms: entactin, entactin 1, nidogen-1, entactin-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18073
VEGA: 13
HGNC: HGNC:7821
Homologene: 1878
Ccdc162
Name: coiled-coil domain containing 162
Synonyms: 5033413D22Rik, Gm29096, Gm6976
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75973
Homologene: 136355
Vmn1r209
Name: vomeronasal 1 receptor 209
Synonyms: Gm11315
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 432736
Homologene: 110880
Psme1
Name: proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)
Synonyms: PA28a
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19186
HGNC: HGNC:9568
Homologene: 4560
Nxpe4
Name: neurexophilin and PC-esterase domain family, member 4
Synonyms: D930028F11Rik, Fam55d
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244853
VEGA: 9
Homologene: 83471
Kcnmb1
Name: potassium large conductance calcium-activated channel, subfamily M, beta member 1
Synonyms: BK channel beta subunit, BKbeta1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16533
HGNC: HGNC:6285
Homologene: 3054
Eepd1
Name: endonuclease/exonuclease/phosphatase family domain containing 1
Synonyms: 2310005P05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67484
Homologene: 12144
Mia
Name: MIA SH3 domain containing
Synonyms: Cdrap, Mia1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12587
HGNC: HGNC:7076
Homologene: 4763
B3gnt8
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8
Synonyms: B3galt7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232984
Homologene: 18886
Sst
Name: somatostatin
Synonyms: SRIF, preprosomatostatin, SOM, Smst
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20604
VEGA: 16
Homologene: 819
Or8s2
Name: olfactory receptor family 8 subfamily S member 2
Synonyms: GA_x6K02T2NBG7-5351896-5352825, MOR160-1, Olfr283
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 259038
Homologene: 64944
Rpl23a
Name: ribosomal protein L23A
Synonyms: MDA20
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268449
Homologene: 110453
Tmem185b
Name: transmembrane protein 185B
Synonyms: 2500001K11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226351
Homologene: 15760
Ankrd31
Name: ankyrin repeat domain 31
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 625662
Homologene: 110355
Cc2d2b
Name: coiled-coil and C2 domain containing 2B
Synonyms: EG668310
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 668310
Homologene: 141114
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 10,141,613 bp
  • A to T, chromosome 1 at 40,327,370 bp
  • C to T, chromosome 1 at 58,447,494 bp
  • A to G, chromosome 1 at 75,487,273 bp
  • C to T, chromosome 1 at 87,475,104 bp
  • T to A, chromosome 1 at 91,085,059 bp
  • C to T, chromosome 1 at 119,526,468 bp
  • T to A, chromosome 2 at 32,761,687 bp
  • C to T, chromosome 2 at 69,549,038 bp
  • T to A, chromosome 2 at 82,977,337 bp
  • T to C, chromosome 2 at 84,373,385 bp
  • CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA to CAAGAAAACTGAAAATCA, chromosome 2 at 98,667,016 bp
  • T to C, chromosome 2 at 155,578,359 bp
  • A to T, chromosome 3 at 31,223,446 bp
  • A to T, chromosome 3 at 127,046,782 bp
  • T to C, chromosome 3 at 132,886,003 bp
  • T to A, chromosome 4 at 59,390,576 bp
  • A to T, chromosome 4 at 108,479,211 bp
  • A to G, chromosome 4 at 139,083,550 bp
  • A to T, chromosome 4 at 141,407,849 bp
  • A to G, chromosome 5 at 32,738,411 bp
  • A to G, chromosome 5 at 100,663,790 bp
  • A to G, chromosome 5 at 112,918,831 bp
  • C to T, chromosome 5 at 144,214,027 bp
  • T to A, chromosome 6 at 17,549,138 bp
  • A to T, chromosome 6 at 87,844,092 bp
  • T to C, chromosome 6 at 113,495,835 bp
  • T to A, chromosome 6 at 126,954,815 bp
  • A to G, chromosome 7 at 25,237,389 bp
  • G to A, chromosome 7 at 25,629,234 bp
  • C to A, chromosome 7 at 27,180,805 bp
  • T to A, chromosome 7 at 27,180,806 bp
  • T to C, chromosome 7 at 30,178,867 bp
  • G to T, chromosome 7 at 62,379,693 bp
  • C to T, chromosome 7 at 80,386,811 bp
  • A to T, chromosome 7 at 105,086,122 bp
  • C to T, chromosome 7 at 105,713,648 bp
  • T to C, chromosome 7 at 120,216,303 bp
  • A to T, chromosome 8 at 67,713,293 bp
  • A to T, chromosome 8 at 70,892,583 bp
  • T to C, chromosome 8 at 71,482,190 bp
  • T to C, chromosome 9 at 25,483,222 bp
  • T to A, chromosome 9 at 48,398,950 bp
  • T to A, chromosome 9 at 83,868,060 bp
  • A to G, chromosome 10 at 41,655,444 bp
  • A to T, chromosome 10 at 61,347,036 bp
  • A to C, chromosome 10 at 79,182,094 bp
  • A to G, chromosome 11 at 33,964,825 bp
  • A to T, chromosome 11 at 73,009,995 bp
  • T to C, chromosome 11 at 78,182,894 bp
  • A to G, chromosome 11 at 90,535,441 bp
  • A to T, chromosome 11 at 99,986,344 bp
  • A to G, chromosome 11 at 120,723,245 bp
  • T to A, chromosome 12 at 29,811,469 bp
  • T to C, chromosome 12 at 29,990,993 bp
  • T to A, chromosome 12 at 52,097,893 bp
  • T to A, chromosome 13 at 13,463,930 bp
  • A to G, chromosome 13 at 22,806,514 bp
  • A to T, chromosome 13 at 29,625,935 bp
  • C to T, chromosome 13 at 96,832,821 bp
  • C to A, chromosome 13 at 99,432,509 bp
  • T to A, chromosome 14 at 54,992,771 bp
  • A to G, chromosome 14 at 55,580,396 bp
  • A to C, chromosome 14 at 56,020,063 bp
  • A to G, chromosome 15 at 95,927,582 bp
  • A to T, chromosome 15 at 98,378,594 bp
  • T to A, chromosome 16 at 23,889,749 bp
  • T to A, chromosome 16 at 32,252,312 bp
  • A to G, chromosome 16 at 77,081,533 bp
  • A to G, chromosome 17 at 24,383,985 bp
  • G to T, chromosome 18 at 7,926,104 bp
  • A to G, chromosome 18 at 38,313,214 bp
  • T to C, chromosome 18 at 76,137,081 bp
  • C to T, chromosome 18 at 80,117,196 bp
  • A to T, chromosome 19 at 27,420,057 bp
  • A to T, chromosome 19 at 40,809,282 bp
  • C to T, chromosome 19 at 60,834,985 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8903 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068760-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.