Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8903Btlr/Mmmh
Stock Number:
068760-MU
Citation ID:
RRID:MMRRC_068760-MU
Other Names:
R8903 (G1)
Major Collection:

Strain Information

Pald1
Name: phosphatase domain containing, paladin 1
Synonyms: paladin, X99384
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27355
VEGA: 10
Homologene: 8453
Met
Name: met proto-oncogene
Synonyms: HGF receptor, c-Met, Par4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17295
HGNC: HGNC:7029
Homologene: 206
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Map1b
Name: microtubule-associated protein 1B
Synonyms: MAP5, Mtap-5, Mtap5, LC1, Mtap1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17755
VEGA: 13
HGNC: HGNC:6836
Homologene: 38111
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Zbtb7c
Name: zinc finger and BTB domain containing 7C
Synonyms: B230208J24Rik, Zbtb36, Kr-pok
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 207259
VEGA: 18
Homologene: 17070
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 10,141,613 bp
  • A to T, chromosome 1 at 40,327,370 bp
  • C to T, chromosome 1 at 58,447,494 bp
  • A to G, chromosome 1 at 75,487,273 bp
  • C to T, chromosome 1 at 87,475,104 bp
  • T to A, chromosome 1 at 91,085,059 bp
  • C to T, chromosome 1 at 119,526,468 bp
  • T to A, chromosome 2 at 32,761,687 bp
  • C to T, chromosome 2 at 69,549,038 bp
  • T to A, chromosome 2 at 82,977,337 bp
  • T to C, chromosome 2 at 84,373,385 bp
  • CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA to CAAGAAAACTGAAAATCA, chromosome 2 at 98,667,016 bp
  • T to C, chromosome 2 at 155,578,359 bp
  • A to T, chromosome 3 at 31,223,446 bp
  • A to T, chromosome 3 at 127,046,782 bp
  • T to C, chromosome 3 at 132,886,003 bp
  • T to A, chromosome 4 at 59,390,576 bp
  • A to T, chromosome 4 at 108,479,211 bp
  • A to G, chromosome 4 at 139,083,550 bp
  • A to T, chromosome 4 at 141,407,849 bp
  • A to G, chromosome 5 at 32,738,411 bp
  • A to G, chromosome 5 at 100,663,790 bp
  • A to G, chromosome 5 at 112,918,831 bp
  • C to T, chromosome 5 at 144,214,027 bp
  • T to A, chromosome 6 at 17,549,138 bp
  • A to T, chromosome 6 at 87,844,092 bp
  • T to C, chromosome 6 at 113,495,835 bp
  • T to A, chromosome 6 at 126,954,815 bp
  • A to G, chromosome 7 at 25,237,389 bp
  • G to A, chromosome 7 at 25,629,234 bp
  • C to A, chromosome 7 at 27,180,805 bp
  • T to A, chromosome 7 at 27,180,806 bp
  • T to C, chromosome 7 at 30,178,867 bp
  • G to T, chromosome 7 at 62,379,693 bp
  • C to T, chromosome 7 at 80,386,811 bp
  • A to T, chromosome 7 at 105,086,122 bp
  • C to T, chromosome 7 at 105,713,648 bp
  • T to C, chromosome 7 at 120,216,303 bp
  • A to T, chromosome 8 at 67,713,293 bp
  • A to T, chromosome 8 at 70,892,583 bp
  • T to C, chromosome 8 at 71,482,190 bp
  • T to C, chromosome 9 at 25,483,222 bp
  • T to A, chromosome 9 at 48,398,950 bp
  • T to A, chromosome 9 at 83,868,060 bp
  • A to G, chromosome 10 at 41,655,444 bp
  • A to T, chromosome 10 at 61,347,036 bp
  • A to C, chromosome 10 at 79,182,094 bp
  • A to G, chromosome 11 at 33,964,825 bp
  • A to T, chromosome 11 at 73,009,995 bp
  • T to C, chromosome 11 at 78,182,894 bp
  • A to G, chromosome 11 at 90,535,441 bp
  • A to T, chromosome 11 at 99,986,344 bp
  • A to G, chromosome 11 at 120,723,245 bp
  • T to A, chromosome 12 at 29,811,469 bp
  • T to C, chromosome 12 at 29,990,993 bp
  • T to A, chromosome 12 at 52,097,893 bp
  • T to A, chromosome 13 at 13,463,930 bp
  • A to G, chromosome 13 at 22,806,514 bp
  • A to T, chromosome 13 at 29,625,935 bp
  • C to T, chromosome 13 at 96,832,821 bp
  • C to A, chromosome 13 at 99,432,509 bp
  • T to A, chromosome 14 at 54,992,771 bp
  • A to G, chromosome 14 at 55,580,396 bp
  • A to C, chromosome 14 at 56,020,063 bp
  • A to G, chromosome 15 at 95,927,582 bp
  • A to T, chromosome 15 at 98,378,594 bp
  • T to A, chromosome 16 at 23,889,749 bp
  • T to A, chromosome 16 at 32,252,312 bp
  • A to G, chromosome 16 at 77,081,533 bp
  • A to G, chromosome 17 at 24,383,985 bp
  • G to T, chromosome 18 at 7,926,104 bp
  • A to G, chromosome 18 at 38,313,214 bp
  • T to C, chromosome 18 at 76,137,081 bp
  • C to T, chromosome 18 at 80,117,196 bp
  • A to T, chromosome 19 at 27,420,057 bp
  • A to T, chromosome 19 at 40,809,282 bp
  • C to T, chromosome 19 at 60,834,985 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8903 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068760-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.