Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8922Btlr/Mmmh
Stock Number:
068767-MU
Citation ID:
RRID:MMRRC_068767-MU
Other Names:
R8922 (G1)
Major Collection:

Strain Information

Aldh1l1
Name: aldehyde dehydrogenase 1 family, member L1
Synonyms: 1810048F20Rik, Fthfd
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107747
HGNC: HGNC:3978
Homologene: 122031
Rprd2
Name: regulation of nuclear pre-mRNA domain containing 2
Synonyms: 6720469I21Rik, 2810036A19Rik, 4930535B03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75137
Homologene: 19997
Scrib
Name: scribbled planar cell polarity
Synonyms: Scrb1, Crc
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105782
Homologene: 44228
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Sec24d
Name: SEC24 homolog D, COPII coat complex component
Synonyms: 2310020L09Rik, LOC383951
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69608
Homologene: 40986
Ccdc91
Name: coiled-coil domain containing 91
Synonyms: 1700086G08Rik, 1810060J02Rik, p56
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67015
Homologene: 10131
Luzp1
Name: leucine zipper protein 1
Synonyms: Luzp, 2700072H04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269593
Homologene: 11545
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 6,248,970 bp
  • G to T, chromosome 1 at 131,801,115 bp
  • C to T, chromosome 1 at 151,192,904 bp
  • A to C, chromosome 2 at 24,732,328 bp
  • A to T, chromosome 2 at 26,006,609 bp
  • G to A, chromosome 2 at 73,287,709 bp
  • C to A, chromosome 2 at 76,712,284 bp
  • A to G, chromosome 2 at 79,255,594 bp
  • C to A, chromosome 2 at 90,052,351 bp
  • T to C, chromosome 2 at 103,752,593 bp
  • A to T, chromosome 3 at 14,866,892 bp
  • T to A, chromosome 3 at 83,837,768 bp
  • A to G, chromosome 3 at 86,356,666 bp
  • G to T, chromosome 3 at 95,780,584 bp
  • A to G, chromosome 3 at 108,560,225 bp
  • G to A, chromosome 3 at 123,350,839 bp
  • A to G, chromosome 4 at 53,544,545 bp
  • T to C, chromosome 4 at 88,820,194 bp
  • C to T, chromosome 4 at 124,658,383 bp
  • T to C, chromosome 4 at 134,885,316 bp
  • T to C, chromosome 4 at 135,764,911 bp
  • C to T, chromosome 4 at 136,542,922 bp
  • C to T, chromosome 5 at 25,951,596 bp
  • A to T, chromosome 5 at 100,036,560 bp
  • A to G, chromosome 5 at 125,086,875 bp
  • T to C, chromosome 5 at 135,747,780 bp
  • T to C, chromosome 6 at 29,456,836 bp
  • T to A, chromosome 6 at 57,843,844 bp
  • T to A, chromosome 6 at 90,559,274 bp
  • T to C, chromosome 6 at 133,850,091 bp
  • C to T, chromosome 6 at 147,510,860 bp
  • T to C, chromosome 7 at 25,664,248 bp
  • C to A, chromosome 7 at 26,611,400 bp
  • C to T, chromosome 7 at 30,523,992 bp
  • T to C, chromosome 7 at 102,678,343 bp
  • C to A, chromosome 7 at 105,091,262 bp
  • T to A, chromosome 7 at 108,508,750 bp
  • G to T, chromosome 7 at 116,418,424 bp
  • TGGGGACCAGCTCAGCCACGGGGACCAGCTC to TGGGGACCAGCTCAGCCACGGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,570 bp
  • T to A, chromosome 7 at 133,674,271 bp
  • T to A, chromosome 7 at 140,373,476 bp
  • A to T, chromosome 8 at 23,250,272 bp
  • A to T, chromosome 8 at 43,520,179 bp
  • A to G, chromosome 8 at 72,305,109 bp
  • A to G, chromosome 8 at 87,568,549 bp
  • T to A, chromosome 8 at 105,018,124 bp
  • G to T, chromosome 9 at 43,322,339 bp
  • A to G, chromosome 9 at 48,832,557 bp
  • G to T, chromosome 9 at 65,074,511 bp
  • T to C, chromosome 9 at 78,470,646 bp
  • T to C, chromosome 9 at 106,451,636 bp
  • A to T, chromosome 9 at 113,896,660 bp
  • C to A, chromosome 9 at 119,534,700 bp
  • A to T, chromosome 9 at 122,796,036 bp
  • A to G, chromosome 11 at 78,032,599 bp
  • A to T, chromosome 11 at 102,054,202 bp
  • A to G, chromosome 11 at 107,649,159 bp
  • C to T, chromosome 12 at 84,017,311 bp
  • A to T, chromosome 12 at 112,123,396 bp
  • A to T, chromosome 13 at 30,871,855 bp
  • A to G, chromosome 13 at 120,264,130 bp
  • A to C, chromosome 14 at 34,592,998 bp
  • A to G, chromosome 14 at 62,673,054 bp
  • G to A, chromosome 14 at 65,054,806 bp
  • A to G, chromosome 15 at 9,172,144 bp
  • C to T, chromosome 15 at 76,061,738 bp
  • A to T, chromosome 15 at 90,572,010 bp
  • T to C, chromosome 15 at 98,814,266 bp
  • T to C, chromosome 16 at 5,105,951 bp
  • A to T, chromosome 16 at 20,728,930 bp
  • T to A, chromosome 16 at 30,065,907 bp
  • A to T, chromosome 16 at 43,577,605 bp
  • C to T, chromosome 16 at 44,451,667 bp
  • A to C, chromosome 16 at 87,896,279 bp
  • A to G, chromosome 18 at 5,213,422 bp
  • A to G, chromosome 19 at 3,404,163 bp
  • A to G, chromosome 19 at 5,873,267 bp
  • A to G, chromosome 19 at 12,884,094 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8922 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068767-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.