Strain Name:
C57BL/6J-MtgxR8924Btlr/Mmmh
Stock Number:
068769-MU
Citation ID:
RRID:MMRRC_068769-MU
Other Names:
R8924 (G1)
Major Collection:

Strain Information

Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
Atn1
Name: atrophin 1
Synonyms: atrophin-1, Atr1, Drpla
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13498
HGNC: HGNC:3033
Homologene: 1461
Odc1
Name: ornithine decarboxylase, structural 1
Synonyms: ODC
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18263
VEGA: 12
HGNC: HGNC:8109
Homologene: 1906
Galnt10
Name: polypeptide N-acetylgalactosaminyltransferase 10
Synonyms: GalNAc-T10, Galnt9, C330012K04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171212
Homologene: 14924
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Clasrp
Name: CLK4-associating serine/arginine rich protein
Synonyms: SWAP2, Sfrs16, Srsf16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53609
Homologene: 134306
Map3k4
Name: mitogen-activated protein kinase kinase kinase 4
Synonyms: MTK1, MAPKKK4, RP17, D17Rp17, D17Rp17e, Mekk4, T-associated sex reversal, Tas
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26407
VEGA: 17
HGNC: HGNC:6856
Homologene: 31346
Usp32
Name: ubiquitin specific peptidase 32
Synonyms: 6430526O11Rik, 2900074J03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237898
Homologene: 13066
Sin3b
Name: transcriptional regulator, SIN3B (yeast)
Synonyms: 2810430C10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20467
Homologene: 81810
Yeats2
Name: YEATS domain containing 2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208146
VEGA: 16
Homologene: 9967
Erbin
Name: Erbb2 interacting protein
Synonyms: 1700028E05Rik, Erbin, Erbb2ip
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 59079
Homologene: 41282
Gpa33
Name: glycoprotein A33 transmembrane
Synonyms: A33 antigen, 2210401D16Rik, 2010310L10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 59290
HGNC: HGNC:4445
Homologene: 4245
Eif2ak4
Name: eukaryotic translation initiation factor 2 alpha kinase 4
Synonyms: GCN2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27103
Homologene: 40891
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Myo9b
Name: myosin IXb
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17925
HGNC: HGNC:7609
Homologene: 3058
Stip1
Name: stress-induced phosphoprotein 1
Synonyms: p60, IEF SSP 3521, Hop, Hsp70/Hsp90 organizing protein, STI1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20867
VEGA: 19
Homologene: 4965
Esr1
Name: estrogen receptor 1 (alpha)
Synonyms: ESR, ERalpha, ER[a], Nr3a1, ERa, Estr, Estra, ER-alpha
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13982
HGNC: HGNC:3467
Homologene: 47906
Gcfc2
Name: GC-rich sequence DNA binding factor 2
Synonyms: AW146020
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330361
HGNC: HGNC:1317
Homologene: 2411
Efna1
Name: ephrin A1
Synonyms: B61, Epl1, EFL-1, LERK-1, Lerk1, Eplg1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13636
HGNC: HGNC:3221
Homologene: 3262
Plpp1
Name: phospholipid phosphatase 1
Synonyms: mPAP, Lipid phosphate phosphatase 1, LPP1, LPP-1, Hpic53, Ppap2a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19012
VEGA: 13
HGNC: HGNC:9228
Homologene: 134049
Chodl
Name: chondrolectin
Synonyms: MT75, 3110074E07Rik, PRED12
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 246048
Homologene: 11795
Ms4a14
Name: membrane-spanning 4-domains, subfamily A, member 14
Synonyms: LOC383435
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 383435
Homologene: 138453
Stim1
Name: stromal interaction molecule 1
Synonyms: SIM
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20866
Homologene: 20681
Eif2ak3
Name: eukaryotic translation initiation factor 2 alpha kinase 3
Synonyms: PERK
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13666
HGNC: HGNC:3255
Homologene: 3557
Snrnp48
Name: small nuclear ribonucleoprotein 48 (U11/U12)
Synonyms: 1110050F08Rik, 6530403A03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67797
VEGA: 13
Homologene: 12191
Cep152
Name: centrosomal protein 152
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99100
Homologene: 37159
Efl1
Name: elongation factor like GTPase 1
Synonyms: 4932434J20Rik, 6030468D11Rik, D7Ertd791e, Eftud1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101592
Homologene: 11599
Dnajc16
Name: DnaJ heat shock protein family (Hsp40) member C16
Synonyms: 2900037O03Rik, 4732437J24Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 214063
Homologene: 45414
Srcap
Name: Snf2-related CREBBP activator protein
Synonyms: F630004O05Rik, B930091H02Rik, D030022P06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043597
Homologene: 38213
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Ank1
Name: ankyrin 1, erythroid
Synonyms: Ank-1, pale
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11733
HGNC: HGNC:492
Homologene: 55427
Ptpn13
Name: protein tyrosine phosphatase, non-receptor type 13
Synonyms: PTP-BL, Ptpri, PTPL1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19249
HGNC: HGNC:9646
Homologene: 7909
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: Scy, Crsh, crash, Adgrc1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Ptprd
Name: protein tyrosine phosphatase receptor type D
Synonyms: 3000002J10Rik, B230219D21Rik, 1110002J03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19266
HGNC: HGNC:9668
Zscan10
Name: zinc finger and SCAN domain containing 10
Synonyms: Zscan10, Zfp206
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 332221
Homologene: 13122
Gh
Name: growth hormone
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14599
Homologene: 47932
Klra3
Name: killer cell lectin-like receptor, subfamily A, member 3
Synonyms: 5E6, Ly49C, Nk-2, Ly49c, NK-2.1, Nk2.1, Nk2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16634
Homologene: 110821
Clcn2
Name: chloride channel, voltage-sensitive 2
Synonyms: Clc2, ClC-2, nmf240
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12724
HGNC: HGNC:2020
Homologene: 3213
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 105242472
Gm12695
Name: predicted gene 12695
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 620779
Homologene: 51847
Trim45
Name: tripartite motif-containing 45
Synonyms: 4921530N01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229644
Homologene: 11865
Zfp804a
Name: zinc finger protein 804A
Synonyms: C630007C17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241514
Homologene: 18461
Capn12
Name: calpain 12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 60594
Homologene: 77333
Fem1b
Name: fem 1 homolog b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14155
VEGA: 9
HGNC: HGNC:3649
Homologene: 7714
Abca8b
Name: ATP-binding cassette, sub-family A member 8b
Synonyms: Abca8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27404
HGNC: HGNC:38
Homologene: 56029
Klra2
Name: killer cell lectin-like receptor, subfamily A, member 2
Synonyms: Ly49b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16633
Homologene: 133782
Sacs
Name: sacsin
Synonyms: E130115J16Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50720
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Fam171a2
Name: family with sequence similarity 171, member A2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217219
Homologene: 19144
Vmn2r53
Name: vomeronasal 2, receptor 53
Synonyms: EG637908
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637908
Homologene: 104040
Cntln
Name: centlein, centrosomal protein
Synonyms: B430108F07Rik, D530005L17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 338349
Homologene: 9805
Cd96
Name: CD96 antigen
Synonyms: Tactile, 1700109I12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 84544
Homologene: 68489
Sun1
Name: Sad1 and UNC84 domain containing 1
Synonyms: 4632417G13Rik, 5730434D03Rik, Unc84a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77053
Homologene: 11544
Kctd1
Name: potassium channel tetramerisation domain containing 1
Synonyms: 4933402K10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106931
VEGA: 18
Homologene: 65999
Card14
Name: caspase recruitment domain family, member 14
Synonyms: CARMA2, Bimp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170720
Homologene: 11469
Efcab12
Name: EF-hand calcium binding domain 12
Synonyms: BC060267
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 212516
Homologene: 18905
Ces3b
Name: carboxylesterase 3B
Synonyms: ES31L, Gm4738
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13909
HGNC: HGNC:1865
Homologene: 84407
Fap
Name: fibroblast activation protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14089
HGNC: HGNC:3590
Homologene: 48282
Cyp2j12
Name: cytochrome P450, family 2, subfamily j, polypeptide 12
Synonyms: OTTMUSG00000007939, Cyp2j12-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242546
HGNC: HGNC:2634
Homologene: 133195
Obsl1
Name: obscurin-like 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98733
Cilp2
Name: cartilage intermediate layer protein 2
Synonyms: CLIP-2, 1110031K21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68709
Homologene: 17713
Hlf
Name: hepatic leukemia factor
Synonyms: E230015K02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217082
HGNC: HGNC:4977
Homologene: 31074
Rcn3
Name: reticulocalbin 3, EF-hand calcium binding domain
Synonyms: 6030455P07Rik, RLP49, D7Ertd671e, D530026G20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52377
Homologene: 10775
Ugt2b35
Name: UDP glucuronosyltransferase 2 family, polypeptide B35
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243085
Homologene: 128251
Scel
Name: sciellin
Synonyms: 9230114I02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64929
VEGA: 14
Homologene: 2850
Prdm13
Name: PR domain containing 13
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230025
Homologene: 11000
Ro60
Name: Ro60, Y RNA binding protein
Synonyms: SS-A/Ro, Ssa, A530054J02Rik, 1810007I17Rik, Ssa2, Trove2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20822
Homologene: 3383
Fam90a1a
Name: family with sequence similarity 90, member A1A
Synonyms: C86695
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 97476
Homologene: 135718
Nab1
Name: Ngfi-A binding protein 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17936
HGNC: HGNC:7626
Homologene: 4352
B3galt1
Name: UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 1
Synonyms: 6330417G03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26877
HGNC: HGNC:916
Homologene: 41362
Irgm1
Name: immunity-related GTPase family M member 1
Synonyms: LRG-47, Iigp3, Ifi1, Irgm
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15944
Homologene: 134089
Or8b52
Name: olfactory receptor family 8 subfamily B member 52
Synonyms: GA_x6K02T2PVTD-32368166-32367237, MOR168-2P, Olfr917
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258183
VEGA: 9
Gnas
Name: GNAS complex locus
Synonyms: Gnas1, Gs-alpha, Gs alpha, G alpha s, Nesp55, P2, P3, P1, neuroendocrine-specific Golgi protein p55 isoform 1, XLalphas, Gsa, Nesp, Gnasxl, Nespl, Oedsml, Galphas, SCG6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14683
HGNC: HGNC:4392
Homologene: 55534
Gal3st2b
Name: galactose-3-O-sulfotransferase 2B
Synonyms: Gm9994
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100041596
Homologene: 41471
Ptpn18
Name: protein tyrosine phosphatase, non-receptor type 18
Synonyms: HSCF, FLP1, Ptpk1, PTP-K1, PTP-HSCF
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19253
HGNC: HGNC:9649
Homologene: 74971
Klrh1
Name: killer cell lectin-like receptor subfamily H, member 1
Synonyms: LOC232415, Gm156
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232415
Homologene: 16395
Mmel1
Name: membrane metallo-endopeptidase-like 1
Synonyms: Nl1, NEPLP gamma, NEPLP beta, NEPLP alpha, SEP, Mell1, Nep2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27390
Homologene: 22778
Or2a5
Name: olfactory receptor family 2 subfamily A member 5
Synonyms: GA_x6K02T2P3E9-4663051-4662119, MOR261-13, Olfr448
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258270
HGNC: HGNC:8232
Homologene: 64846
Serpinb2
Name: serine (or cysteine) peptidase inhibitor, clade B, member 2
Synonyms: PAI-2, Planh2, ovalbumin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18788
HGNC: HGNC:8584
Homologene: 20571
Krtap24-1
Name: keratin associated protein 24-1
Synonyms: LOC239932, Gm312
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239932
VEGA: 16
Homologene: 88056
Gjd3
Name: gap junction protein, delta 3
Synonyms: Gja11, connexin-30.2, cx30.2, connexin 30.2, Gjc1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 353155
Homologene: 17530
Cd27
Name: CD27 antigen
Synonyms: Cd27, S152, Tp55, Tnfrsf7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21940
Homologene: 74386
Sva
Name: seminal vesicle antigen
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20939
Defb21
Name: defensin beta 21
Synonyms: LOC228782, 4930525K10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 403172
Snx18
Name: sorting nexin 18
Synonyms: Snag1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 170625
VEGA: 13
Homologene: 14164
Cfap54
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, Gm872, 4930485B16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Ttc6
Name: tetratricopeptide repeat domain 6
Synonyms: LOC217602, EG639426, Gm9813, 4921506M07Rik, AU024163
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70846
Homologene: 78002
Cd37
Name: CD37 antigen
Synonyms: Tspan26
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12493
HGNC: HGNC:1666
Homologene: 20422
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 34,459,885 bp
  • T to C, chromosome 1 at 52,490,508 bp
  • T to C, chromosome 1 at 75,506,197 bp
  • G to T, chromosome 1 at 93,940,931 bp
  • A to T, chromosome 1 at 107,515,554 bp
  • C to T, chromosome 1 at 143,765,432 bp
  • T to C, chromosome 1 at 166,152,782 bp
  • A to T, chromosome 2 at 62,547,821 bp
  • C to T, chromosome 2 at 68,118,715 bp
  • A to G, chromosome 2 at 82,258,403 bp
  • T to A, chromosome 2 at 118,428,032 bp
  • A to G, chromosome 2 at 125,602,858 bp
  • T to C, chromosome 2 at 152,574,784 bp
  • A to G, chromosome 2 at 174,299,484 bp
  • T to C, chromosome 3 at 89,276,328 bp
  • A to G, chromosome 3 at 100,928,078 bp
  • G to A, chromosome 4 at 21,679,125 bp
  • A to G, chromosome 4 at 75,998,499 bp
  • T to A, chromosome 4 at 84,888,699 bp
  • A to C, chromosome 4 at 96,106,448 bp
  • T to A, chromosome 4 at 96,762,809 bp
  • G to T, chromosome 4 at 141,766,707 bp
  • A to G, chromosome 4 at 154,889,634 bp
  • T to C, chromosome 5 at 25,298,887 bp
  • T to A, chromosome 5 at 67,033,132 bp
  • A to G, chromosome 5 at 87,004,921 bp
  • A to T, chromosome 5 at 103,591,235 bp
  • A to G, chromosome 5 at 139,223,635 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • T to A, chromosome 6 at 42,042,248 bp
  • T to G, chromosome 6 at 42,897,030 bp
  • T to C, chromosome 6 at 70,893,019 bp
  • T to C, chromosome 6 at 81,932,898 bp
  • G to T, chromosome 6 at 115,823,703 bp
  • A to T, chromosome 6 at 124,745,248 bp
  • T to C, chromosome 6 at 125,236,469 bp
  • G to T, chromosome 6 at 129,768,121 bp
  • C to T, chromosome 6 at 130,335,769 bp
  • T to C, chromosome 6 at 131,228,251 bp
  • G to T, chromosome 7 at 12,600,825 bp
  • T to C, chromosome 7 at 19,584,307 bp
  • G to A, chromosome 7 at 28,883,203 bp
  • G to T, chromosome 7 at 45,083,671 bp
  • A to G, chromosome 7 at 45,238,685 bp
  • G to A, chromosome 7 at 82,762,953 bp
  • GCG to GCGACGGCGCCG, chromosome 7 at 97,579,907 bp
  • A to G, chromosome 7 at 102,428,807 bp
  • T to A, chromosome 7 at 127,559,032 bp
  • T to C, chromosome 8 at 21,961,413 bp
  • T to C, chromosome 8 at 23,098,995 bp
  • A to G, chromosome 8 at 69,886,458 bp
  • A to G, chromosome 8 at 71,349,031 bp
  • A to G, chromosome 8 at 72,746,503 bp
  • G to A, chromosome 8 at 105,084,987 bp
  • T to C, chromosome 9 at 38,665,484 bp
  • T to C, chromosome 9 at 62,797,634 bp
  • G to A, chromosome 10 at 4,857,176 bp
  • T to C, chromosome 10 at 82,295,461 bp
  • T to G, chromosome 10 at 93,001,823 bp
  • A to G, chromosome 11 at 48,865,871 bp
  • G to A, chromosome 11 at 57,783,855 bp
  • C to T, chromosome 11 at 85,025,544 bp
  • T to C, chromosome 11 at 90,345,888 bp
  • C to T, chromosome 11 at 98,982,499 bp
  • T to C, chromosome 11 at 102,440,035 bp
  • AACTCTA to AA, chromosome 11 at 104,915,427 bp
  • T to C, chromosome 11 at 106,300,808 bp
  • A to G, chromosome 11 at 109,947,177 bp
  • T to C, chromosome 11 at 119,326,104 bp
  • C to T, chromosome 11 at 120,276,765 bp
  • A to G, chromosome 12 at 17,548,328 bp
  • G to A, chromosome 12 at 57,651,004 bp
  • A to G, chromosome 12 at 75,896,670 bp
  • T to A, chromosome 13 at 38,216,421 bp
  • C to A, chromosome 13 at 103,839,458 bp
  • T to A, chromosome 13 at 112,806,523 bp
  • T to G, chromosome 13 at 113,618,395 bp
  • T to A, chromosome 14 at 61,192,446 bp
  • T to C, chromosome 14 at 61,211,253 bp
  • A to G, chromosome 14 at 103,592,371 bp
  • T to C, chromosome 15 at 86,032,470 bp
  • T to C, chromosome 16 at 20,150,562 bp
  • C to T, chromosome 16 at 20,712,180 bp
  • A to G, chromosome 16 at 46,099,022 bp
  • A to T, chromosome 16 at 78,941,771 bp
  • A to C, chromosome 16 at 88,612,000 bp
  • A to G, chromosome 17 at 12,271,546 bp
  • A to T, chromosome 17 at 23,605,606 bp
  • T to C, chromosome 18 at 14,969,688 bp
  • A to T, chromosome 19 at 7,025,319 bp
  • A to T, chromosome 19 at 11,303,749 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8924 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068769-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.