Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8924Btlr/Mmmh
Stock Number:
068769-MU
Citation ID:
RRID:MMRRC_068769-MU
Other Names:
R8924 (G1)
Major Collection:

Strain Information

Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Limch1
Name: LIM and calponin homology domains 1
Synonyms: 3732412D22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77569
Homologene: 18953
Atn1
Name: atrophin 1
Synonyms: atrophin-1, Atr1, Drpla
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13498
HGNC: HGNC:3033
Homologene: 1461
Odc1
Name: ornithine decarboxylase, structural 1
Synonyms: ODC
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18263
VEGA: 12
HGNC: HGNC:8109
Homologene: 1906
Galnt10
Name: polypeptide N-acetylgalactosaminyltransferase 10
Synonyms: GalNAc-T10, Galnt9, C330012K04Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171212
Homologene: 14924
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Clasrp
Name: CLK4-associating serine/arginine rich protein
Synonyms: SWAP2, Srsf16, Sfrs16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53609
Homologene: 134306
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 34,459,885 bp
  • T to C, chromosome 1 at 52,490,508 bp
  • T to C, chromosome 1 at 75,506,197 bp
  • G to T, chromosome 1 at 93,940,931 bp
  • A to T, chromosome 1 at 107,515,554 bp
  • C to T, chromosome 1 at 143,765,432 bp
  • T to C, chromosome 1 at 166,152,782 bp
  • A to T, chromosome 2 at 62,547,821 bp
  • C to T, chromosome 2 at 68,118,715 bp
  • A to G, chromosome 2 at 82,258,403 bp
  • T to A, chromosome 2 at 118,428,032 bp
  • A to G, chromosome 2 at 125,602,858 bp
  • T to C, chromosome 2 at 152,574,784 bp
  • A to G, chromosome 2 at 174,299,484 bp
  • T to C, chromosome 3 at 89,276,328 bp
  • A to G, chromosome 3 at 100,928,078 bp
  • G to A, chromosome 4 at 21,679,125 bp
  • A to G, chromosome 4 at 75,998,499 bp
  • T to A, chromosome 4 at 84,888,699 bp
  • A to C, chromosome 4 at 96,106,448 bp
  • T to A, chromosome 4 at 96,762,809 bp
  • G to T, chromosome 4 at 141,766,707 bp
  • A to G, chromosome 4 at 154,889,634 bp
  • T to C, chromosome 5 at 25,298,887 bp
  • T to A, chromosome 5 at 67,033,132 bp
  • A to G, chromosome 5 at 87,004,921 bp
  • A to T, chromosome 5 at 103,591,235 bp
  • A to G, chromosome 5 at 139,223,635 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • T to A, chromosome 6 at 42,042,248 bp
  • T to G, chromosome 6 at 42,897,030 bp
  • T to C, chromosome 6 at 70,893,019 bp
  • T to C, chromosome 6 at 81,932,898 bp
  • G to T, chromosome 6 at 115,823,703 bp
  • A to T, chromosome 6 at 124,745,248 bp
  • T to C, chromosome 6 at 125,236,469 bp
  • G to T, chromosome 6 at 129,768,121 bp
  • C to T, chromosome 6 at 130,335,769 bp
  • T to C, chromosome 6 at 131,228,251 bp
  • G to T, chromosome 7 at 12,600,825 bp
  • T to C, chromosome 7 at 19,584,307 bp
  • G to A, chromosome 7 at 28,883,203 bp
  • G to T, chromosome 7 at 45,083,671 bp
  • A to G, chromosome 7 at 45,238,685 bp
  • G to A, chromosome 7 at 82,762,953 bp
  • GCG to GCGACGGCGCCG, chromosome 7 at 97,579,907 bp
  • A to G, chromosome 7 at 102,428,807 bp
  • T to A, chromosome 7 at 127,559,032 bp
  • T to C, chromosome 8 at 21,961,413 bp
  • T to C, chromosome 8 at 23,098,995 bp
  • A to G, chromosome 8 at 69,886,458 bp
  • A to G, chromosome 8 at 71,349,031 bp
  • A to G, chromosome 8 at 72,746,503 bp
  • G to A, chromosome 8 at 105,084,987 bp
  • T to C, chromosome 9 at 38,665,484 bp
  • T to C, chromosome 9 at 62,797,634 bp
  • G to A, chromosome 10 at 4,857,176 bp
  • T to C, chromosome 10 at 82,295,461 bp
  • T to G, chromosome 10 at 93,001,823 bp
  • A to G, chromosome 11 at 48,865,871 bp
  • G to A, chromosome 11 at 57,783,855 bp
  • C to T, chromosome 11 at 85,025,544 bp
  • T to C, chromosome 11 at 90,345,888 bp
  • C to T, chromosome 11 at 98,982,499 bp
  • T to C, chromosome 11 at 102,440,035 bp
  • AACTCTA to AA, chromosome 11 at 104,915,427 bp
  • T to C, chromosome 11 at 106,300,808 bp
  • A to G, chromosome 11 at 109,947,177 bp
  • T to C, chromosome 11 at 119,326,104 bp
  • C to T, chromosome 11 at 120,276,765 bp
  • A to G, chromosome 12 at 17,548,328 bp
  • G to A, chromosome 12 at 57,651,004 bp
  • A to G, chromosome 12 at 75,896,670 bp
  • T to A, chromosome 13 at 38,216,421 bp
  • C to A, chromosome 13 at 103,839,458 bp
  • T to A, chromosome 13 at 112,806,523 bp
  • T to G, chromosome 13 at 113,618,395 bp
  • T to A, chromosome 14 at 61,192,446 bp
  • T to C, chromosome 14 at 61,211,253 bp
  • A to G, chromosome 14 at 103,592,371 bp
  • T to C, chromosome 15 at 86,032,470 bp
  • T to C, chromosome 16 at 20,150,562 bp
  • C to T, chromosome 16 at 20,712,180 bp
  • A to G, chromosome 16 at 46,099,022 bp
  • A to T, chromosome 16 at 78,941,771 bp
  • A to C, chromosome 16 at 88,612,000 bp
  • A to G, chromosome 17 at 12,271,546 bp
  • A to T, chromosome 17 at 23,605,606 bp
  • T to C, chromosome 18 at 14,969,688 bp
  • A to T, chromosome 19 at 7,025,319 bp
  • A to T, chromosome 19 at 11,303,749 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8924 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068769-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.