Strain Name:
C57BL/6J-MtgxR8963Btlr/Mmmh
Stock Number:
068797-MU
Citation ID:
RRID:MMRRC_068797-MU
Other Names:
R8963 (G1)
Major Collection:

Strain Information

Elavl4
Name: ELAV like RNA binding protein 4
Synonyms: Hud
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15572
HGNC: HGNC:3315
Homologene: 40729
Slc6a2
Name: solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
Synonyms: NE transporter, NET, Slc6a5, norepinephrine transporter
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20538
Homologene: 816
Ebf2
Name: early B cell factor 2
Synonyms: O/E-3, Mmot1, D14Ggc1e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13592
Homologene: 56471
Sptan1
Name: spectrin alpha, non-erythrocytic 1
Synonyms: alphaII-spectrin, 2610027H02Rik, Spna-2, alpha-fodrin, Spna2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20740
Homologene: 2353
Plxnd1
Name: plexin D1
Synonyms: b2b1863Clo, 6230425C21Rik, b2b553Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: G431004K08Rik, GCN1L, Gcn1l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Map4k4
Name: mitogen-activated protein kinase kinase kinase kinase 4
Synonyms: Nik, 9430080K19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26921
HGNC: HGNC:6866
Homologene: 7442
Rrm1
Name: ribonucleotide reductase M1
Synonyms: RnrM1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20133
Homologene: 806
Katnb1
Name: katanin p80 (WD40-containing) subunit B 1
Synonyms: 2410003J24Rik, KAT
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74187
HGNC: HGNC:6217
Homologene: 4302
Daam1
Name: dishevelled associated activator of morphogenesis 1
Synonyms: 1700066F09Rik, 2310028E21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 208846
VEGA: 12
Homologene: 36635
Tsc22d1
Name: TSC22 domain family, member 1
Synonyms: Egr5, Tgfb1i4, TSC-22
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21807
Homologene: 7573
Nsmaf
Name: neutral sphingomyelinase (N-SMase) activation associated factor
Synonyms: Fan, factor associated with N-SMase activation
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18201
HGNC: HGNC:8017
Homologene: 2652
Ankrd28
Name: ankyrin repeat domain 28
Synonyms: E430019N21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105522
VEGA: 14
Homologene: 35374
Cyp51
Name: cytochrome P450, family 51
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13121
HGNC: HGNC:2649
Homologene: 55488
Polr1b
Name: polymerase (RNA) I polypeptide B
Synonyms: D630020H17Rik, 128kDa, Rpo1-2, RPA116, RPA2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20017
Homologene: 7133
Slc6a11
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 11
Synonyms: D930045G19Rik, E130202I16Rik, GAT4, Gat3, Gabt4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243616
Homologene: 129935
Scaf4
Name: SR-related CTD-associated factor 4
Synonyms: Srsf15, Sfrs15, Sra4
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224432
VEGA: 16
Homologene: 16227
Adamts12
Name: ADAM metallopeptidase with thrombospondin type 1 motif 12
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239337
VEGA: 15
Homologene: 12808
Hrct1
Name: histidine rich carboxyl terminus 1
Synonyms: 3830408D24Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100039781
F11r
Name: F11 receptor
Synonyms: JAM-1, Ly106, ESTM33, BV11 antigen, Jcam1, JAM-A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16456
Homologene: 14255
Ccdc88a
Name: coiled coil domain containing 88A
Synonyms: C130096N06Rik, D130005J21Rik, Girdin, HkRP1, A430106J12Rik, C330012F17Rik, GIV
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 108686
Homologene: 41180
Taf6l
Name: TATA-box binding protein associated factor 6 like
Synonyms: C530024J06Rik, PAF65A, 2810417N14Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225895
Homologene: 4728
Clvs2
Name: clavesin 2
Synonyms: Rlbp1l2, A330019N05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215890
Homologene: 27894
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: D930026N18Rik, (alpha)1 subunit, L-type Cav1.2, Cchl1a1, Cav1.2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Nlrp1b
Name: NLR family, pyrin domain containing 1B
Synonyms: Nalp1b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 637515
Homologene: 19080
Ankrd35
Name: ankyrin repeat domain 35
Synonyms: 4732436F15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213121
Homologene: 16977
Helz2
Name: helicase with zinc finger 2, transcriptional coactivator
Synonyms: BC006779
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 229003
Homologene: 14118
Polr2g
Name: polymerase (RNA) II (DNA directed) polypeptide G
Synonyms: Rpo2-7l, RBP7, 2410046K11Rik, A230108L04Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67710
VEGA: 19
HGNC: HGNC:9194
Homologene: 2019
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: Mgr1, Gpr98, Mass1, VLGR1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Lrpap1
Name: low density lipoprotein receptor-related protein associated protein 1
Synonyms: RAP
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16976
HGNC: HGNC:6701
Homologene: 37612
Grin2b
Name: glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms: GluN2B, GluRepsilon2, Nmdar2b, NMDAR2B, NR2B
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14812
HGNC: HGNC:4586
Homologene: 646
Elapor2
Name: endosome-lysosome associated apoptosis and autophagy regulator family member 2
Synonyms: 9330182L06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231014
Homologene: 27396
Ccdc150
Name: coiled-coil domain containing 150
Synonyms: 4930511H11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 78016
Homologene: 15814
Chrnd
Name: cholinergic receptor, nicotinic, delta polypeptide
Synonyms: Acrd, Achr-4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11447
HGNC: HGNC:1965
Homologene: 37340
Greb1
Name: gene regulated by estrogen in breast cancer protein
Synonyms: 5730583K22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 268527
Homologene: 8780
Aatk
Name: apoptosis-associated tyrosine kinase
Synonyms: AATYK1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11302
HGNC: HGNC:21
Homologene: 74861
Vmn2r53
Name: vomeronasal 2, receptor 53
Synonyms: EG637908
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 637908
Homologene: 104040
Me1
Name: malic enzyme 1, NADP(+)-dependent, cytosolic
Synonyms: Mod1, Mod-1, D9Ertd267e, Mdh-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17436
HGNC: HGNC:6983
Homologene: 134785
Il27ra
Name: interleukin 27 receptor, alpha
Synonyms: Tccr, WSX-1, IL-27R
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50931
Homologene: 3562
Map7d1
Name: MAP7 domain containing 1
Synonyms: Parcc1, Mtap7d1, Rprc1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 245877
Homologene: 17009
Kif26b
Name: kinesin family member 26B
Synonyms: N-11 kinesin, D230039L06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269152
Homologene: 18623
Large1
Name: LARGE xylosyl- and glucuronyltransferase 1
Synonyms: fg, enr, BPFD#36, froggy
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16795
HGNC: HGNC:6511
Homologene: 7810
Rad51ap2
Name: RAD51 associated protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 209550
VEGA: 12
Homologene: 85245
Cyp2c40
Name: cytochrome P450, family 2, subfamily c, polypeptide 40
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13099
Homologene: 74936
Foxred2
Name: FAD-dependent oxidoreductase domain containing 2
Synonyms: LOC239554, A430097D04Rik, D15Bwg0759e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239554
Homologene: 11800
Ctif
Name: CBP80/20-dependent translation initiation factor
Synonyms: Gm672, LOC269037
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 269037
VEGA: 18
Homologene: 56682
Skint8
Name: selection and upkeep of intraepithelial T cells 8
Synonyms: OTTMUSG00000009475
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 639774
Homologene: 106613
Thoc2l
Name: THO complex subunit 2-like
Synonyms: BC005561, Gm3179
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100042165
Chml
Name: choroideremia-like
Synonyms: Rep2, E030003F13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12663
HGNC: HGNC:1941
Homologene: 31055
Klra10
Name: killer cell lectin-like receptor subfamily A, member 10
Synonyms: Ly49i2, Ly49J
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16628
Homologene: 110821
Zfp938
Name: zinc finger protein 938
Synonyms: B230315N10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237411
Homologene: 135924
Iqca1
Name: IQ motif containing with AAA domain 1
Synonyms: 4930465P12Rik, Iqca, 4930585L22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74918
Homologene: 49784
Cbll1
Name: Casitas B-lineage lymphoma-like 1
Synonyms: c-Cbl-like, Hakai
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104836
Homologene: 11734
Or8g2
Name: olfactory receptor family 8 subfamily G member 2
Synonyms: MOR171-14, GA_x6K02T02EEW-227-373, GA_x6K02T2PVTD-33608180-33608971, Olfr229, Olfr973
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258606
VEGA: 9
Homologene: 115513
Ankrd44
Name: ankyrin repeat domain 44
Synonyms: E130014H08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329154
Homologene: 27547
P4ha2
Name: procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha II polypeptide
Synonyms: P4hl
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18452
HGNC: HGNC:8547
Homologene: 55806
Itgb1bp1
Name: integrin beta 1 binding protein 1
Synonyms: bodenin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16413
Homologene: 3496
Apol7b
Name: apolipoprotein L 7b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 278679
HGNC: HGNC:619
Homologene: 40940
Vav3
Name: vav 3 oncogene
Synonyms: A530094I06Rik, Idd18.1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 57257
Homologene: 38143
Or4g17
Name: olfactory receptor family 4 subfamily G member 17
Synonyms: MOR245-13, GA_x6K02T2Q125-72430580-72431515, Olfr1284
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258379
Homologene: 74059
Klhdc2
Name: kelch domain containing 2
Synonyms: D12Ertd522e, 2310022K15Rik, HCLP-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69554
Homologene: 8631
Or12e8
Name: olfactory receptor family 12 subfamily E member 8
Synonyms: Olfr1120, MOR264-2, GA_x6K02T2Q125-48849180-48850100
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259031
Homologene: 72054
Pramel12
Name: PRAME like 12
Synonyms: Pramef8, 4732496O08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242736
Homologene: 128393
Adora2b
Name: adenosine A2b receptor
Synonyms: AA2BR, A2BAR, ARA2B, A2b, A2BR, A2b, Rs
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11541
HGNC: HGNC:264
Homologene: 20167
Ska1
Name: spindle and kinetochore associated complex subunit 1
Synonyms: 2810433K01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66468
VEGA: 18
Homologene: 11975
Sirt6
Name: sirtuin 6
Synonyms: 2810449N18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 50721
Homologene: 6924
Gatad1
Name: GATA zinc finger domain containing 1
Synonyms: 2810047M21Rik, B330017N08Rik, 9130430G15Rik, Odag, 2310031E19Rik, 8430439A17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67210
Homologene: 56916
Or4n5
Name: olfactory receptor family 4 subfamily N member 5
Synonyms: Olfr722, MOR241-3, GA_x6K02T2PMLR-5566715-5565789
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258487
Homologene: 17270
Nrip2
Name: nuclear receptor interacting protein 2
Synonyms: NIX1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 60345
Homologene: 11023
Sftpd
Name: surfactant associated protein D
Synonyms: Sfpd, SP-D, Sftp4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 20390
VEGA: 14
Homologene: 2272
Pcdha9
Name: protocadherin alpha 9
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 192161
HGNC: HGNC:8664
Homologene: 130700
Mab21l1
Name: mab-21-like 1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17116
HGNC: HGNC:6757
Homologene: 36183
Unc5cl
Name: unc-5 family C-terminal like
Synonyms: 2510009H09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76589
Homologene: 18319
Cfap54
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, Gm872, 4930485B16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Igkv12-46
Name: immunoglobulin kappa variable 12-46
Synonyms: Gm16849
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 692245
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 40,000,580 bp
  • A to C, chromosome 1 at 54,272,482 bp
  • G to A, chromosome 1 at 54,762,379 bp
  • A to T, chromosome 1 at 87,194,881 bp
  • G to T, chromosome 1 at 90,139,927 bp
  • A to G, chromosome 1 at 171,460,937 bp
  • A to T, chromosome 1 at 175,687,035 bp
  • G to A, chromosome 1 at 178,916,149 bp
  • T to C, chromosome 2 at 29,983,732 bp
  • G to A, chromosome 2 at 40,998,184 bp
  • T to A, chromosome 2 at 87,357,606 bp
  • A to T, chromosome 2 at 111,379,300 bp
  • A to G, chromosome 2 at 112,836,670 bp
  • A to G, chromosome 2 at 129,115,656 bp
  • A to T, chromosome 2 at 181,229,614 bp
  • A to G, chromosome 3 at 55,782,927 bp
  • T to A, chromosome 3 at 96,679,687 bp
  • A to G, chromosome 3 at 109,682,913 bp
  • A to G, chromosome 4 at 6,428,471 bp
  • A to T, chromosome 4 at 43,727,564 bp
  • A to T, chromosome 4 at 110,206,579 bp
  • G to A, chromosome 4 at 111,937,044 bp
  • A to G, chromosome 4 at 126,236,682 bp
  • T to C, chromosome 4 at 143,417,659 bp
  • A to C, chromosome 5 at 3,641,544 bp
  • C to A, chromosome 5 at 4,086,519 bp
  • T to A, chromosome 5 at 9,437,792 bp
  • T to A, chromosome 5 at 35,097,657 bp
  • T to C, chromosome 5 at 104,517,786 bp
  • T to A, chromosome 5 at 115,589,094 bp
  • A to T, chromosome 6 at 69,764,770 bp
  • A to G, chromosome 6 at 114,225,821 bp
  • G to T, chromosome 6 at 115,972,545 bp
  • A to T, chromosome 6 at 118,742,271 bp
  • A to G, chromosome 6 at 128,408,325 bp
  • A to T, chromosome 6 at 130,272,654 bp
  • A to G, chromosome 6 at 136,044,009 bp
  • A to G, chromosome 7 at 12,581,999 bp
  • A to T, chromosome 7 at 102,456,532 bp
  • A to T, chromosome 8 at 72,815,984 bp
  • T to A, chromosome 8 at 84,041,082 bp
  • A to T, chromosome 8 at 92,989,074 bp
  • T to C, chromosome 8 at 95,082,891 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • A to G, chromosome 9 at 39,910,199 bp
  • A to T, chromosome 9 at 86,598,791 bp
  • A to T, chromosome 10 at 33,622,681 bp
  • A to G, chromosome 10 at 81,626,544 bp
  • A to T, chromosome 10 at 82,225,453 bp
  • C to A, chromosome 10 at 93,028,700 bp
  • T to A, chromosome 11 at 29,498,416 bp
  • T to C, chromosome 11 at 54,114,169 bp
  • C to T, chromosome 11 at 62,249,157 bp
  • A to G, chromosome 11 at 71,217,832 bp
  • T to C, chromosome 11 at 120,012,137 bp
  • A to C, chromosome 12 at 11,456,254 bp
  • A to T, chromosome 12 at 16,724,884 bp
  • C to T, chromosome 12 at 21,274,863 bp
  • A to T, chromosome 12 at 31,488,200 bp
  • A to T, chromosome 12 at 69,300,291 bp
  • A to G, chromosome 12 at 71,945,244 bp
  • C to T, chromosome 12 at 114,612,244 bp
  • A to T, chromosome 13 at 81,419,469 bp
  • A to G, chromosome 14 at 31,755,741 bp
  • A to G, chromosome 14 at 41,183,044 bp
  • A to T, chromosome 14 at 49,895,052 bp
  • G to T, chromosome 14 at 67,428,105 bp
  • T to C, chromosome 14 at 76,418,826 bp
  • T to C, chromosome 15 at 11,317,357 bp
  • T to C, chromosome 15 at 77,423,920 bp
  • T to A, chromosome 15 at 77,945,605 bp
  • GGCTGCTGCTGCTGCTGCTGCTGCTG to GGCTGCTGCTGCTGCTGCTGCTG, chromosome 16 at 90,229,857 bp
  • A to G, chromosome 17 at 48,462,333 bp
  • A to T, chromosome 18 at 36,998,697 bp
  • C to T, chromosome 18 at 74,197,568 bp
  • CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC to CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC, chromosome 18 at 75,471,803 bp
  • T to A, chromosome 19 at 8,774,771 bp
  • T to C, chromosome 19 at 8,794,149 bp
  • T to A, chromosome 19 at 39,767,482 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8963 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068797-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.