Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8963Btlr/Mmmh
Stock Number:
068797-MU
Citation ID:
RRID:MMRRC_068797-MU
Other Names:
R8963 (G1)
Major Collection:

Strain Information

Slc6a2
Name: solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2
Synonyms: Slc6a5, NE transporter, NET, norepinephrine transporter
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20538
Homologene: 816
Ebf2
Name: early B cell factor 2
Synonyms: O/E-3, D14Ggc1e, Mmot1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13592
Homologene: 56471
Sptan1
Name: spectrin alpha, non-erythrocytic 1
Synonyms: alpha-fodrin, Spna-2, 2610027H02Rik, Spna2, alphaII-spectrin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20740
Homologene: 2353
Plxnd1
Name: plexin D1
Synonyms: 6230425C21Rik, b2b553Clo, b2b1863Clo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67784
HGNC: HGNC:9107
Homologene: 22866
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Map4k4
Name: mitogen-activated protein kinase kinase kinase kinase 4
Synonyms: Nik, 9430080K19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26921
HGNC: HGNC:6866
Homologene: 7442
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 40,000,580 bp
  • A to C, chromosome 1 at 54,272,482 bp
  • G to A, chromosome 1 at 54,762,379 bp
  • A to T, chromosome 1 at 87,194,881 bp
  • G to T, chromosome 1 at 90,139,927 bp
  • A to G, chromosome 1 at 171,460,937 bp
  • A to T, chromosome 1 at 175,687,035 bp
  • G to A, chromosome 1 at 178,916,149 bp
  • T to C, chromosome 2 at 29,983,732 bp
  • G to A, chromosome 2 at 40,998,184 bp
  • T to A, chromosome 2 at 87,357,606 bp
  • A to T, chromosome 2 at 111,379,300 bp
  • A to G, chromosome 2 at 112,836,670 bp
  • A to G, chromosome 2 at 129,115,656 bp
  • A to T, chromosome 2 at 181,229,614 bp
  • A to G, chromosome 3 at 55,782,927 bp
  • T to A, chromosome 3 at 96,679,687 bp
  • A to G, chromosome 3 at 109,682,913 bp
  • A to G, chromosome 4 at 6,428,471 bp
  • A to T, chromosome 4 at 43,727,564 bp
  • A to T, chromosome 4 at 110,206,579 bp
  • G to A, chromosome 4 at 111,937,044 bp
  • A to G, chromosome 4 at 126,236,682 bp
  • T to C, chromosome 4 at 143,417,659 bp
  • A to C, chromosome 5 at 3,641,544 bp
  • C to A, chromosome 5 at 4,086,519 bp
  • T to A, chromosome 5 at 9,437,792 bp
  • T to A, chromosome 5 at 35,097,657 bp
  • T to C, chromosome 5 at 104,517,786 bp
  • T to A, chromosome 5 at 115,589,094 bp
  • A to T, chromosome 6 at 69,764,770 bp
  • A to G, chromosome 6 at 114,225,821 bp
  • G to T, chromosome 6 at 115,972,545 bp
  • A to T, chromosome 6 at 118,742,271 bp
  • A to G, chromosome 6 at 128,408,325 bp
  • A to T, chromosome 6 at 130,272,654 bp
  • A to G, chromosome 6 at 136,044,009 bp
  • A to G, chromosome 7 at 12,581,999 bp
  • A to T, chromosome 7 at 102,456,532 bp
  • A to T, chromosome 8 at 72,815,984 bp
  • T to A, chromosome 8 at 84,041,082 bp
  • A to T, chromosome 8 at 92,989,074 bp
  • T to C, chromosome 8 at 95,082,891 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • A to G, chromosome 9 at 39,910,199 bp
  • A to T, chromosome 9 at 86,598,791 bp
  • A to T, chromosome 10 at 33,622,681 bp
  • A to G, chromosome 10 at 81,626,544 bp
  • A to T, chromosome 10 at 82,225,453 bp
  • C to A, chromosome 10 at 93,028,700 bp
  • T to A, chromosome 11 at 29,498,416 bp
  • T to C, chromosome 11 at 54,114,169 bp
  • C to T, chromosome 11 at 62,249,157 bp
  • A to G, chromosome 11 at 71,217,832 bp
  • T to C, chromosome 11 at 120,012,137 bp
  • A to C, chromosome 12 at 11,456,254 bp
  • A to T, chromosome 12 at 16,724,884 bp
  • C to T, chromosome 12 at 21,274,863 bp
  • A to T, chromosome 12 at 31,488,200 bp
  • A to T, chromosome 12 at 69,300,291 bp
  • A to G, chromosome 12 at 71,945,244 bp
  • C to T, chromosome 12 at 114,612,244 bp
  • A to T, chromosome 13 at 81,419,469 bp
  • A to G, chromosome 14 at 31,755,741 bp
  • A to G, chromosome 14 at 41,183,044 bp
  • A to T, chromosome 14 at 49,895,052 bp
  • G to T, chromosome 14 at 67,428,105 bp
  • T to C, chromosome 14 at 76,418,826 bp
  • T to C, chromosome 15 at 11,317,357 bp
  • T to C, chromosome 15 at 77,423,920 bp
  • T to A, chromosome 15 at 77,945,605 bp
  • GGCTGCTGCTGCTGCTGCTGCTGCTG to GGCTGCTGCTGCTGCTGCTGCTG, chromosome 16 at 90,229,857 bp
  • A to G, chromosome 17 at 48,462,333 bp
  • A to T, chromosome 18 at 36,998,697 bp
  • C to T, chromosome 18 at 74,197,568 bp
  • CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC to CGGGGCACACTTTGCTCTTACCTCCCGGAGGCACGTGTAGATGGGGCACAC, chromosome 18 at 75,471,803 bp
  • T to A, chromosome 19 at 8,774,771 bp
  • T to C, chromosome 19 at 8,794,149 bp
  • T to A, chromosome 19 at 39,767,482 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8963 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068797-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.