Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8978Btlr/Mmmh
Stock Number:
068811-MU
Citation ID:
RRID:MMRRC_068811-MU
Other Names:
R8978 (G1)
Major Collection:

Strain Information

Ebf2
Name: early B cell factor 2
Synonyms: O/E-3, D14Ggc1e, Mmot1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13592
Homologene: 56471
Crhr1
Name: corticotropin releasing hormone receptor 1
Synonyms: CRFR1, CRF-R1alpha, CRF 1 receptor, CRF1R
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12921
Homologene: 20920
Chgb
Name: chromogranin B
Synonyms: secretogranin I, Scg-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12653
HGNC: HGNC:1930
Homologene: 1375
Fancd2
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211651
HGNC: HGNC:3585
Homologene: 13212
Mtif3
Name: mitochondrial translational initiation factor 3
Synonyms: 2810012L14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76366
Homologene: 49927
Zfp568
Name: zinc finger protein 568
Synonyms: LOC381866, chato
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243905
Homologene: 136307
Suds3
Name: suppressor of defective silencing 3 homolog (S. cerevisiae)
Synonyms: 2400003N08Rik, 2410008L21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71954
Homologene: 15906
Orc2
Name: origin recognition complex, subunit 2
Synonyms: Orc2l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18393
HGNC: HGNC:8488
Homologene: 4512
Dcaf8
Name: DDB1 and CUL4 associated factor 8
Synonyms: H326, D1Ucla4, D1Dau35e, Wdr42a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98193
Homologene: 56725
Mon2
Name: MON2 homolog, regulator of endosome to Golgi trafficking
Synonyms: SF21, 2610528O22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67074
VEGA: 10
Homologene: 44309
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Rara
Name: retinoic acid receptor, alpha
Synonyms: RARalpha1, RAR alpha 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19401
HGNC: HGNC:9864
Homologene: 20262
Itprid2
Name: ITPR interacting domain containing 2
Synonyms: SPAG13, CS-1, CS1, KRAP, Ssfa2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70599
Homologene: 4912
Cdc27
Name: cell division cycle 27
Synonyms: APC3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217232
HGNC: HGNC:1728
Homologene: 960
Tk2
Name: thymidine kinase 2, mitochondrial
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 57813
Homologene: 3392
Mier2
Name: MIER family member 2
Synonyms: 2700087H15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70427
Homologene: 18941
Ift122
Name: intraflagellar transport 122
Synonyms: C86139, Wdr10, sopb
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 81896
Homologene: 12819
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Pcn, Plc, perlecan
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Trim25
Name: tripartite motif-containing 25
Synonyms: estrogen-responsive finger protein, Zfp147
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217069
Homologene: 48325
Nfatc3
Name: nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3
Synonyms: NFAT4, NFATx, D8Ertd281e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18021
HGNC: HGNC:7777
Homologene: 27827
Gipc1
Name: GIPC PDZ domain containing family, member 1
Synonyms: synectin, TIP-2, Semcap1, neurophilin1-IP, Glut1CIP, TaxIP2, Rgs19ip1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67903
HGNC: HGNC:1226
Homologene: 21167
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Tub
Name: TUB bipartite transcription factor
Synonyms: rd5, tub
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22141
Homologene: 31147
Adamts6
Name: ADAM metallopeptidase with thrombospondin type 1 motif 6
Synonyms: ADAM-TS6, A930019D11Rik, b2b2228Clo, b2b2187.1Clo, b2b2182Clo, b2b2029Clo, b2b1879.1Clo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 108154
VEGA: 13
HGNC: HGNC:222
Homologene: 82573
Tgfbi
Name: transforming growth factor, beta induced
Synonyms: bIG-h3, 68kDa, Beta-ig
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21810
VEGA: 13
Homologene: 37294
Abcg4
Name: ATP binding cassette subfamily G member 4
Synonyms: 6430517O04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 192663
Homologene: 75179
Mroh4
Name: maestro heat-like repeat family member 4
Synonyms: 1700016M24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69439
Homologene: 72545
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Rabl6
Name: RAB, member RAS oncogene family-like 6
Synonyms: Rbel1b, Rbel1, Rbel1a, B230208H17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227624
Homologene: 11674
Synm
Name: synemin, intermediate filament protein
Synonyms: 4930412K21Rik, Synemin, Dmn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233335
Homologene: 9081
Myh2
Name: myosin, heavy polypeptide 2, skeletal muscle, adult
Synonyms: MyHC-IIa, MHC2A, Myhs-f, Myhs-f1, Myhsf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17882
HGNC: HGNC:7572
Homologene: 23019
Ltbp2
Name: latent transforming growth factor beta binding protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16997
HGNC: HGNC:6715
Homologene: 369
Col9a1
Name: collagen, type IX, alpha 1
Synonyms: Col9a-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12839
HGNC: HGNC:2217
Homologene: 1393
Adam39
Name: a disintegrin and metallopeptidase domain 39
Synonyms: 1700056P18Rik, testase 9
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546055
HGNC: HGNC:199
Homologene: 128364
Ctnnb1
Name: catenin beta 1
Synonyms: beta-catenin, Catnb, beta catenin, catenin (cadherin associated protein), beta 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12387
HGNC: HGNC:2514
Homologene: 1434
Spef2
Name: sperm flagellar 2
Synonyms: C230086A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 320277
Homologene: 23371
Or13a17
Name: olfactory receptor family 13 subfamily A member 17
Synonyms: IB6, MOR253-2, GA_x6K02T2PBJ9-42837030-42837962, Olfr45
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18344
Homologene: 79416
Kctd1
Name: potassium channel tetramerisation domain containing 1
Synonyms: 4933402K10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106931
VEGA: 18
Homologene: 65999
Itgbl1
Name: integrin, beta-like 1
Synonyms: with EGF-like repeat domains, B930011D01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 223272
HGNC: HGNC:6164
Homologene: 3519
Slc6a15
Name: solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms: v7-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103098
VEGA: 10
Homologene: 18163
Gm1110
Name: predicted gene 1110
Synonyms: LOC382064
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382064
VEGA: 9
Homologene: 78608
Cdadc1
Name: cytidine and dCMP deaminase domain containing 1
Synonyms: NYD-SP15, 2310010M10Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71891
VEGA: 14
Homologene: 12794
Zfp683
Name: zinc finger protein 683
Synonyms: Hobit
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100503878
Rigi
Name: RNA sensor RIG-I
Synonyms: 6430573D20Rik, RIG-I, DEAD (Asp-Glu-Ala-Asp) box polypeptide 58, Ddx58
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230073
Homologene: 32215
Sult1b1
Name: sulfotransferase family 1B, member 1
Synonyms: Dopa/tyrosine sulfotransferase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56362
Homologene: 69169
Pih1d2
Name: PIH1 domain containing 2
Synonyms: 2700059L22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72614
Homologene: 12474
Zbtb34
Name: zinc finger and BTB domain containing 34
Synonyms: LOC241311
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241311
Homologene: 19382
Fkbp10
Name: FK506 binding protein 10
Synonyms: FKBP65, Fkbp1-rs, Fkbp-rs1, Fkbp6, 65kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14230
Homologene: 7718
Thrb
Name: thyroid hormone receptor beta
Synonyms: T3Rbeta, T3R[b], Nr1a2, TR beta, c-erbAbeta, Thrb2, Thrb1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21834
Homologene: 36025
Gsdmc3
Name: gasdermin C3
Synonyms: 9930109F21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 270328
HGNC: HGNC:7151
Homologene: 69487
Or2w2
Name: olfactory receptor family 2 subfamily W member 2
Synonyms: GA_x6K02T2QHY8-11663090-11664010, MOR256-13, Olfr1364
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 258533
Homologene: 64885
Adamts14
Name: ADAM metallopeptidase with thrombospondin type 1 motif 14
Synonyms: TS14, Adamts-14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237360
Homologene: 16383
Celf3
Name: CUGBP, Elav-like family member 3
Synonyms: BRUNOL1, ERDA4, CAGH4, 4930415M08Rik, Tnrc4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 78784
Homologene: 48510
Pate7
Name: prostate and testis expressed 7
Synonyms: Gm17727
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100312986
Homologene: 129804
Kyat3
Name: kynurenine aminotransferase 3
Synonyms: Kat3, KATIII, Ccbl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229905
Homologene: 2994
Prickle4
Name: prickle planar cell polarity protein 4
Synonyms: LOC381104
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381104
Homologene: 22752
Or7g21
Name: olfactory receptor family 7 subfamily G member 21
Synonyms: GA_x6K02T2PVTD-12857805-12858749, MOR152-3, Olfr836
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258557
HGNC: HGNC:8466
Homologene: 115507
Rhoq
Name: ras homolog family member Q
Synonyms: TC10, Arhq
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 104215
Homologene: 22704
Pcdhga6
Name: protocadherin gamma subfamily A, 6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93714
HGNC: HGNC:8704
Homologene: 129611
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 24,239,315 bp
  • T to C, chromosome 1 at 58,472,340 bp
  • G to A, chromosome 1 at 172,194,557 bp
  • G to A, chromosome 2 at 25,587,529 bp
  • A to G, chromosome 2 at 33,411,036 bp
  • T to A, chromosome 2 at 79,660,913 bp
  • T to C, chromosome 2 at 132,792,578 bp
  • T to C, chromosome 2 at 138,284,135 bp
  • A to G, chromosome 3 at 94,485,360 bp
  • C to T, chromosome 3 at 142,737,835 bp
  • A to G, chromosome 4 at 40,239,650 bp
  • A to T, chromosome 4 at 134,053,928 bp
  • A to G, chromosome 4 at 137,564,030 bp
  • A to G, chromosome 5 at 21,885,514 bp
  • A to G, chromosome 5 at 87,535,041 bp
  • A to G, chromosome 5 at 117,094,908 bp
  • A to T, chromosome 5 at 146,959,036 bp
  • A to G, chromosome 6 at 113,585,546 bp
  • T to A, chromosome 6 at 115,925,808 bp
  • T to A, chromosome 7 at 30,017,258 bp
  • C to A, chromosome 7 at 67,734,924 bp
  • T to C, chromosome 7 at 109,030,186 bp
  • T to C, chromosome 7 at 131,037,881 bp
  • A to T, chromosome 7 at 140,691,729 bp
  • A to C, chromosome 8 at 15,921,056 bp
  • A to G, chromosome 8 at 40,825,670 bp
  • T to C, chromosome 8 at 83,662,417 bp
  • A to G, chromosome 8 at 104,231,177 bp
  • G to A, chromosome 8 at 106,108,770 bp
  • A to G, chromosome 8 at 123,134,438 bp
  • T to A, chromosome 9 at 19,121,286 bp
  • A to T, chromosome 9 at 26,895,799 bp
  • A to T, chromosome 9 at 35,776,773 bp
  • A to G, chromosome 9 at 44,281,098 bp
  • A to G, chromosome 9 at 50,624,932 bp
  • A to G, chromosome 9 at 120,957,584 bp
  • T to A, chromosome 10 at 61,203,016 bp
  • A to C, chromosome 10 at 79,540,956 bp
  • T to C, chromosome 10 at 86,949,918 bp
  • G to A, chromosome 10 at 103,395,092 bp
  • T to A, chromosome 10 at 123,035,564 bp
  • A to C, chromosome 11 at 67,177,362 bp
  • A to G, chromosome 11 at 67,189,497 bp
  • T to C, chromosome 11 at 89,016,201 bp
  • T to G, chromosome 11 at 98,971,769 bp
  • A to T, chromosome 11 at 100,423,110 bp
  • T to C, chromosome 11 at 104,173,654 bp
  • C to T, chromosome 11 at 104,508,385 bp
  • T to C, chromosome 12 at 84,787,390 bp
  • T to A, chromosome 13 at 21,574,109 bp
  • C to A, chromosome 13 at 56,630,578 bp
  • T to C, chromosome 13 at 104,375,739 bp
  • T to C, chromosome 14 at 17,981,886 bp
  • G to T, chromosome 14 at 59,575,748 bp
  • G to A, chromosome 14 at 67,424,099 bp
  • A to T, chromosome 14 at 123,972,205 bp
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
  • A to T, chromosome 15 at 9,725,177 bp
  • A to G, chromosome 15 at 63,859,606 bp
  • G to T, chromosome 15 at 74,627,624 bp
  • A to T, chromosome 17 at 47,688,847 bp
  • A to G, chromosome 17 at 57,296,710 bp
  • A to G, chromosome 17 at 57,324,650 bp
  • T to C, chromosome 17 at 86,964,339 bp
  • G to T, chromosome 18 at 14,986,434 bp
  • T to A, chromosome 18 at 37,707,663 bp
  • T to C, chromosome 18 at 49,922,612 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8978 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068811-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.