Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8978Btlr/Mmmh
Stock Number:
068811-MU
Citation ID:
RRID:MMRRC_068811-MU
Other Names:
R8978 (G1)
Major Collection:

Strain Information

Ebf2
Name: early B cell factor 2
Synonyms: O/E-3, D14Ggc1e, Mmot1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13592
Homologene: 56471
Crhr1
Name: corticotropin releasing hormone receptor 1
Synonyms: CRFR1, CRF-R1alpha, CRF 1 receptor, CRF1R
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12921
Homologene: 20920
Chgb
Name: chromogranin B
Synonyms: secretogranin I, Scg-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12653
HGNC: HGNC:1930
Homologene: 1375
Fancd2
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211651
HGNC: HGNC:3585
Homologene: 13212
Mtif3
Name: mitochondrial translational initiation factor 3
Synonyms: 2810012L14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76366
Homologene: 49927
Zfp568
Name: zinc finger protein 568
Synonyms: LOC381866, chato
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243905
Homologene: 136307
Suds3
Name: suppressor of defective silencing 3 homolog (S. cerevisiae)
Synonyms: 2400003N08Rik, 2410008L21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71954
Homologene: 15906
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 24,239,315 bp
  • T to C, chromosome 1 at 58,472,340 bp
  • G to A, chromosome 1 at 172,194,557 bp
  • G to A, chromosome 2 at 25,587,529 bp
  • A to G, chromosome 2 at 33,411,036 bp
  • T to A, chromosome 2 at 79,660,913 bp
  • T to C, chromosome 2 at 132,792,578 bp
  • T to C, chromosome 2 at 138,284,135 bp
  • A to G, chromosome 3 at 94,485,360 bp
  • C to T, chromosome 3 at 142,737,835 bp
  • A to G, chromosome 4 at 40,239,650 bp
  • A to T, chromosome 4 at 134,053,928 bp
  • A to G, chromosome 4 at 137,564,030 bp
  • A to G, chromosome 5 at 21,885,514 bp
  • A to G, chromosome 5 at 87,535,041 bp
  • A to G, chromosome 5 at 117,094,908 bp
  • A to T, chromosome 5 at 146,959,036 bp
  • A to G, chromosome 6 at 113,585,546 bp
  • T to A, chromosome 6 at 115,925,808 bp
  • T to A, chromosome 7 at 30,017,258 bp
  • C to A, chromosome 7 at 67,734,924 bp
  • T to C, chromosome 7 at 109,030,186 bp
  • T to C, chromosome 7 at 131,037,881 bp
  • A to T, chromosome 7 at 140,691,729 bp
  • A to C, chromosome 8 at 15,921,056 bp
  • A to G, chromosome 8 at 40,825,670 bp
  • T to C, chromosome 8 at 83,662,417 bp
  • A to G, chromosome 8 at 104,231,177 bp
  • G to A, chromosome 8 at 106,108,770 bp
  • A to G, chromosome 8 at 123,134,438 bp
  • T to A, chromosome 9 at 19,121,286 bp
  • A to T, chromosome 9 at 26,895,799 bp
  • A to T, chromosome 9 at 35,776,773 bp
  • A to G, chromosome 9 at 44,281,098 bp
  • A to G, chromosome 9 at 50,624,932 bp
  • A to G, chromosome 9 at 120,957,584 bp
  • T to A, chromosome 10 at 61,203,016 bp
  • A to C, chromosome 10 at 79,540,956 bp
  • T to C, chromosome 10 at 86,949,918 bp
  • G to A, chromosome 10 at 103,395,092 bp
  • T to A, chromosome 10 at 123,035,564 bp
  • A to C, chromosome 11 at 67,177,362 bp
  • A to G, chromosome 11 at 67,189,497 bp
  • T to C, chromosome 11 at 89,016,201 bp
  • T to G, chromosome 11 at 98,971,769 bp
  • A to T, chromosome 11 at 100,423,110 bp
  • T to C, chromosome 11 at 104,173,654 bp
  • C to T, chromosome 11 at 104,508,385 bp
  • T to C, chromosome 12 at 84,787,390 bp
  • T to A, chromosome 13 at 21,574,109 bp
  • C to A, chromosome 13 at 56,630,578 bp
  • T to C, chromosome 13 at 104,375,739 bp
  • T to C, chromosome 14 at 17,981,886 bp
  • G to T, chromosome 14 at 59,575,748 bp
  • G to A, chromosome 14 at 67,424,099 bp
  • A to T, chromosome 14 at 123,972,205 bp
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
  • A to T, chromosome 15 at 9,725,177 bp
  • A to G, chromosome 15 at 63,859,606 bp
  • G to T, chromosome 15 at 74,627,624 bp
  • A to T, chromosome 17 at 47,688,847 bp
  • A to G, chromosome 17 at 57,296,710 bp
  • A to G, chromosome 17 at 57,324,650 bp
  • T to C, chromosome 17 at 86,964,339 bp
  • G to T, chromosome 18 at 14,986,434 bp
  • T to A, chromosome 18 at 37,707,663 bp
  • T to C, chromosome 18 at 49,922,612 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8978 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068811-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.