Strain Name:
C57BL/6J-MtgxR8982Btlr/Mmmh
Stock Number:
068815-MU
Citation ID:
RRID:MMRRC_068815-MU
Other Names:
R8982 (G1)
Major Collection:

Strain Information

Nefh
Name: neurofilament, heavy polypeptide
Synonyms: NF-H, NF200, NEFH
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380684
HGNC: HGNC:7737
Homologene: 40755
Htr1d
Name: 5-hydroxytryptamine (serotonin) receptor 1D
Synonyms: Gpcr14, Htr1db
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15552
HGNC: HGNC:5289
Homologene: 20240
Ptprk
Name: protein tyrosine phosphatase receptor type K
Synonyms: PTPk, RPTPkappa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19272
VEGA: 10
HGNC: HGNC:9674
Homologene: 55693
Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Zbtb7c
Name: zinc finger and BTB domain containing 7C
Synonyms: B230208J24Rik, Zbtb36, Kr-pok
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 207259
VEGA: 18
Homologene: 17070
Pck1
Name: phosphoenolpyruvate carboxykinase 1, cytosolic
Synonyms: Pck-1, PEPCK
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18534
HGNC: HGNC:8724
Homologene: 1944
Ckap5
Name: cytoskeleton associated protein 5
Synonyms: 3110043H24Rik, 4930432B04Rik, D730027C18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75786
Homologene: 8844
Pogz
Name: pogo transposable element with ZNF domain
Synonyms: 9530006B08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229584
Homologene: 9022
Cenpc1
Name: centromere protein C1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12617
HGNC: HGNC:1854
Homologene: 1371
Atxn2l
Name: ataxin 2-like
Synonyms: A2RP, A2LG, A2D, A2lp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233871
Homologene: 16513
Arid1b
Name: AT-rich interaction domain 1B
Synonyms: B230217J03Rik, 9330189K18Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 239985
Homologene: 32344
Trp53bp2
Name: transformation related protein 53 binding protein 2
Synonyms: ASPP2, 53BP2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 209456
Homologene: 3959
Clock
Name: clock circadian regulator
Synonyms: 5330400M04Rik, KAT13D, bHLHe8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12753
HGNC: HGNC:2082
Homologene: 3603
Dnah7a
Name: dynein, axonemal, heavy chain 7A
Synonyms: LOC381341, Dnahc7, Dnahc7a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 627872
Homologene: 41287
Trim71
Name: tripartite motif-containing 71
Synonyms: LOC382112, lin-41, mlin-41, Lin41, 2610206G21Rik, 636931, mLin41
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 636931
Homologene: 9076
Nr6a1
Name: nuclear receptor subfamily 6, group A, member 1
Synonyms: Gcnf, NCNF, 1700113M01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14536
HGNC: HGNC:7985
Homologene: 36308
Copb2
Name: COPI coat complex subunit beta 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50797
HGNC: HGNC:2232
Homologene: 3499
Acsl3
Name: acyl-CoA synthetase long-chain family member 3
Synonyms: 2610510B12Rik, C85929, Facl3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74205
HGNC: HGNC:3570
Homologene: 3278
Hrob
Name: homologous recombination factor with OB-fold
Synonyms: BC030867
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217216
Homologene: 69368
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Mecom
Name: MDS1 and EVI1 complex locus
Synonyms: ZNFPR1B1, Prdm3, MDS1-EVI1, Evi-1, D630039M04Rik, Jbo, Evi1, Mds1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14013
HGNC: HGNC:3498
Homologene: 21086
Hoxa13
Name: homeobox A13
Synonyms: Hox-1.10
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15398
HGNC: HGNC:5102
Homologene: 73882
Cfap74
Name: cilia and flagella associated protein 74
Synonyms: 2010015L04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 544678
Homologene: 129584
Sult3a2
Name: sulfotransferase family 3A, member 2
Synonyms: Gm4794
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215895
VEGA: 10
Homologene: 111031
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Zfp385b
Name: zinc finger protein 385B
Synonyms: B830010L13Rik, C130013B13Rik, Zfp533
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241494
Homologene: 17606
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Or5d18
Name: olfactory receptor family 5 subfamily D member 18
Synonyms: mOR-EG, MOR174-9, GA_x6K02T2Q125-49527073-49526132, Olfr73
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 117004
Homologene: 133889
Fhad1
Name: forkhead-associated phosphopeptide binding domain 1
Synonyms: 2900090M10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329977
Homologene: 77947
Zfp804a
Name: zinc finger protein 804A
Synonyms: C630007C17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241514
Homologene: 18461
Nlrp2
Name: NLR family, pyrin domain containing 2
Synonyms: PYPAF2, E330007A02Rik, Nalp2, Pan1, Nbs1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232827
Homologene: 56789
Rfx6
Name: regulatory factor X, 6
Synonyms: 4930572O07Rik, Rfxdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320995
Homologene: 18318
F830045P16Rik
Name: RIKEN cDNA F830045P16 gene
Synonyms: Sirpb3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228592
Homologene: 136180
Krt72
Name: keratin 72
Synonyms: K6irs2, Krt72-ps
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105866
Homologene: 25876
C4b
Name: complement C4B (Chido blood group)
Synonyms: Ss, C4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12268
Homologene: 36030
Col22a1
Name: collagen, type XXII, alpha 1
Synonyms: C80743, 2310067L16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69700
Homologene: 43567
Alpk3
Name: alpha-kinase 3
Synonyms: Midori
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 116904
Homologene: 10813
Pramel23
Name: PRAME like 23
Synonyms: Gm13089
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277667
Zbtb47
Name: zinc finger and BTB domain containing 47
Synonyms: 4732420M22Rik, Zfp651
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270210
VEGA: 9
Homologene: 136302
Rimbp3
Name: RIMS binding protein 3
Synonyms: LOC239731, LOC385766, RIM-BP3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239731
Homologene: 77940
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: 3230402H02Rik, VE-PTP
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Actg2
Name: actin, gamma 2, smooth muscle, enteric
Synonyms: SMGA, Act-4, Act4, Acta3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11468
HGNC: HGNC:145
Homologene: 123845
Psg18
Name: pregnancy specific beta-1-glycoprotein 18
Synonyms: mmCGM6, Cea-3, Cea3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26438
HGNC: HGNC:9524
Homologene: 110989
Hoxc5
Name: homeobox C5
Synonyms: Hox-3.4, Hox-6.2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15424
HGNC: HGNC:5127
Homologene: 41296
Slfn5
Name: schlafen 5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327978
Homologene: 18839
Ces2f
Name: carboxylesterase 2F
Synonyms: 2310038E17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71903
HGNC: HGNC:1864
Homologene: 135673
Or10j2
Name: olfactory receptor family 10 subfamily J member 2
Synonyms: GA_x6K02T2P20D-20826777-20827719, GA_x6K02T2R7CC-581296-580364, MOR267-12P, MOR267-8, Olfr1403, Olfr418-ps1, Olfr418
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258645
HGNC: HGNC:8175
Homologene: 8218
Zdhhc3
Name: zinc finger, DHHC domain containing 3
Synonyms: GODZ, 1810006O10Rik, Zfp373, 1110020O22Rik, 2210017C02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69035
Homologene: 9582
Or10aa1
Name: olfactory receptor family 10 subfamily AA member 1
Synonyms: GA_x6K02T2P20D-21133014-21132070, MOR123-1, Olfr433
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258712
Homologene: 133588
Tmem179
Name: transmembrane protein 179
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104885
VEGA: 12
Homologene: 16809
Srcin1
Name: SRC kinase signaling inhibitor 1
Synonyms: P140, p140Cap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56013
Homologene: 10324
Cep295nl
Name: CEP295 N-terminal like
Synonyms: Ddc8, BC100451
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 58251
Homologene: 75164
Tmem200b
Name: transmembrane protein 200B
Synonyms: EG623230
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 623230
VEGA: 4
Homologene: 79738
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,531,142 bp
  • A to G, chromosome 1 at 78,699,768 bp
  • G to A, chromosome 1 at 173,270,739 bp
  • T to G, chromosome 1 at 174,042,622 bp
  • T to A, chromosome 1 at 182,435,436 bp
  • T to A, chromosome 2 at 32,212,122 bp
  • T to A, chromosome 2 at 38,872,601 bp
  • G to T, chromosome 2 at 77,411,956 bp
  • A to G, chromosome 2 at 82,235,828 bp
  • A to T, chromosome 2 at 88,034,269 bp
  • T to C, chromosome 2 at 91,607,578 bp
  • T to A, chromosome 2 at 129,472,892 bp
  • T to C, chromosome 2 at 173,157,319 bp
  • G to A, chromosome 3 at 29,963,106 bp
  • G to A, chromosome 3 at 94,879,568 bp
  • T to A, chromosome 4 at 131,922,357 bp
  • A to T, chromosome 4 at 136,443,555 bp
  • T to C, chromosome 4 at 142,002,584 bp
  • T to G, chromosome 4 at 143,698,316 bp
  • G to A, chromosome 4 at 155,436,730 bp
  • A to G, chromosome 5 at 76,216,712 bp
  • A to G, chromosome 5 at 86,047,674 bp
  • T to C, chromosome 5 at 121,328,242 bp
  • T to A, chromosome 6 at 52,258,936 bp
  • T to C, chromosome 6 at 83,520,715 bp
  • T to A, chromosome 7 at 5,324,979 bp
  • T to A, chromosome 7 at 18,349,375 bp
  • A to G, chromosome 7 at 81,099,002 bp
  • T to C, chromosome 7 at 119,937,071 bp
  • CCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGC, chromosome 7 at 126,494,248 bp
  • T to A, chromosome 8 at 104,953,035 bp
  • T to C, chromosome 9 at 98,574,111 bp
  • T to C, chromosome 9 at 114,513,736 bp
  • A to G, chromosome 9 at 121,763,268 bp
  • A to G, chromosome 9 at 123,100,513 bp
  • A to T, chromosome 10 at 28,560,142 bp
  • T to C, chromosome 10 at 33,782,073 bp
  • G to A, chromosome 10 at 51,723,819 bp
  • GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT to GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT, chromosome 10 at 116,283,677 bp
  • G to A, chromosome 11 at 4,947,549 bp
  • G to A, chromosome 11 at 82,960,140 bp
  • A to G, chromosome 11 at 97,535,798 bp
  • G to A, chromosome 11 at 102,255,284 bp
  • A to T, chromosome 11 at 118,333,845 bp
  • A to T, chromosome 12 at 112,501,867 bp
  • T to A, chromosome 15 at 44,523,673 bp
  • A to G, chromosome 15 at 71,973,638 bp
  • C to T, chromosome 15 at 101,781,624 bp
  • T to C, chromosome 15 at 103,015,308 bp
  • A to G, chromosome 16 at 17,209,647 bp
  • T to A, chromosome 17 at 5,243,041 bp
  • A to G, chromosome 17 at 34,734,364 bp
  • G to A, chromosome 18 at 76,146,273 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8982 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068815-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.