Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8982Btlr/Mmmh
Stock Number:
068815-MU
Citation ID:
RRID:MMRRC_068815-MU
Other Names:
R8982 (G1)
Major Collection:

Strain Information

Nefh
Name: neurofilament, heavy polypeptide
Synonyms: NF-H, NF200, NEFH
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380684
HGNC: HGNC:7737
Homologene: 40755
Htr1d
Name: 5-hydroxytryptamine (serotonin) receptor 1D
Synonyms: Gpcr14, Htr1db
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15552
HGNC: HGNC:5289
Homologene: 20240
Ptprk
Name: protein tyrosine phosphatase receptor type K
Synonyms: PTPk, RPTPkappa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19272
VEGA: 10
HGNC: HGNC:9674
Homologene: 55693
Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Zbtb7c
Name: zinc finger and BTB domain containing 7C
Synonyms: B230208J24Rik, Zbtb36, Kr-pok
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 207259
VEGA: 18
Homologene: 17070
Pck1
Name: phosphoenolpyruvate carboxykinase 1, cytosolic
Synonyms: Pck-1, PEPCK
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18534
HGNC: HGNC:8724
Homologene: 1944
Ckap5
Name: cytoskeleton associated protein 5
Synonyms: 3110043H24Rik, 4930432B04Rik, D730027C18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75786
Homologene: 8844
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,531,142 bp
  • A to G, chromosome 1 at 78,699,768 bp
  • G to A, chromosome 1 at 173,270,739 bp
  • T to G, chromosome 1 at 174,042,622 bp
  • T to A, chromosome 1 at 182,435,436 bp
  • T to A, chromosome 2 at 32,212,122 bp
  • T to A, chromosome 2 at 38,872,601 bp
  • G to T, chromosome 2 at 77,411,956 bp
  • A to G, chromosome 2 at 82,235,828 bp
  • A to T, chromosome 2 at 88,034,269 bp
  • T to C, chromosome 2 at 91,607,578 bp
  • T to A, chromosome 2 at 129,472,892 bp
  • T to C, chromosome 2 at 173,157,319 bp
  • G to A, chromosome 3 at 29,963,106 bp
  • G to A, chromosome 3 at 94,879,568 bp
  • T to A, chromosome 4 at 131,922,357 bp
  • A to T, chromosome 4 at 136,443,555 bp
  • T to C, chromosome 4 at 142,002,584 bp
  • T to G, chromosome 4 at 143,698,316 bp
  • G to A, chromosome 4 at 155,436,730 bp
  • A to G, chromosome 5 at 76,216,712 bp
  • A to G, chromosome 5 at 86,047,674 bp
  • T to C, chromosome 5 at 121,328,242 bp
  • T to A, chromosome 6 at 52,258,936 bp
  • T to C, chromosome 6 at 83,520,715 bp
  • T to A, chromosome 7 at 5,324,979 bp
  • T to A, chromosome 7 at 18,349,375 bp
  • A to G, chromosome 7 at 81,099,002 bp
  • T to C, chromosome 7 at 119,937,071 bp
  • CCAGCAGCAGCAGCAGCAGC to CCAGCAGCAGCAGCAGC, chromosome 7 at 126,494,248 bp
  • T to A, chromosome 8 at 104,953,035 bp
  • T to C, chromosome 9 at 98,574,111 bp
  • T to C, chromosome 9 at 114,513,736 bp
  • A to G, chromosome 9 at 121,763,268 bp
  • A to G, chromosome 9 at 123,100,513 bp
  • A to T, chromosome 10 at 28,560,142 bp
  • T to C, chromosome 10 at 33,782,073 bp
  • G to A, chromosome 10 at 51,723,819 bp
  • GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT to GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT, chromosome 10 at 116,283,677 bp
  • G to A, chromosome 11 at 4,947,549 bp
  • G to A, chromosome 11 at 82,960,140 bp
  • A to G, chromosome 11 at 97,535,798 bp
  • G to A, chromosome 11 at 102,255,284 bp
  • A to T, chromosome 11 at 118,333,845 bp
  • A to T, chromosome 12 at 112,501,867 bp
  • T to A, chromosome 15 at 44,523,673 bp
  • A to G, chromosome 15 at 71,973,638 bp
  • C to T, chromosome 15 at 101,781,624 bp
  • T to C, chromosome 15 at 103,015,308 bp
  • A to G, chromosome 16 at 17,209,647 bp
  • T to A, chromosome 17 at 5,243,041 bp
  • A to G, chromosome 17 at 34,734,364 bp
  • G to A, chromosome 18 at 76,146,273 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8982 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068815-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.