Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9008Btlr/Mmmh
Stock Number:
068838-MU
Citation ID:
RRID:MMRRC_068838-MU
Other Names:
R9008 (G1)
Major Collection:

Strain Information

Nudt2
Name: nudix hydrolase 2
Synonyms: APAH1, 2310051L06Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66401
HGNC: HGNC:8049
Homologene: 896
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Mov10
Name: Mov10 RISC complex RNA helicase
Synonyms: Mov-10
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17454
HGNC: HGNC:7200
Homologene: 10365
Pnmt
Name: phenylethanolamine-N-methyltransferase
Synonyms: Pent
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18948
HGNC: HGNC:9160
Homologene: 55673
Spmip11
Name: sperm microtubule inner protein 11
Synonyms: 4930415O20Rik, Tex49
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73863
VEGA: 15
Homologene: 19174
Hnrnpr
Name: heterogeneous nuclear ribonucleoprotein R
Synonyms: hnRNPR, 2610003J05Rik, Hnrpr, 2610528B01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74326
HGNC: HGNC:5047
Homologene: 4251
Abcc4
Name: ATP-binding cassette, sub-family C member 4
Synonyms: D630049P08Rik, MOAT-B, MRP4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239273
VEGA: 14
HGNC: HGNC:55
Homologene: 74563
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 53,662,342 bp
  • A to C, chromosome 1 at 75,505,383 bp
  • A to T, chromosome 1 at 79,714,980 bp
  • G to A, chromosome 1 at 105,827,129 bp
  • T to C, chromosome 1 at 127,479,571 bp
  • T to C, chromosome 1 at 150,755,044 bp
  • T to A, chromosome 1 at 174,050,847 bp
  • A to G, chromosome 2 at 26,892,524 bp
  • A to T, chromosome 2 at 76,946,990 bp
  • A to G, chromosome 2 at 101,696,988 bp
  • G to A, chromosome 2 at 103,266,828 bp
  • A to G, chromosome 2 at 112,635,403 bp
  • A to G, chromosome 2 at 119,749,413 bp
  • C to T, chromosome 2 at 122,069,932 bp
  • A to G, chromosome 2 at 138,283,533 bp
  • A to G, chromosome 3 at 3,643,036 bp
  • A to C, chromosome 3 at 87,368,665 bp
  • T to A, chromosome 3 at 98,162,718 bp
  • C to T, chromosome 3 at 100,027,626 bp
  • A to G, chromosome 3 at 104,800,016 bp
  • C to T, chromosome 3 at 138,955,416 bp
  • A to T, chromosome 4 at 25,254,778 bp
  • G to A, chromosome 4 at 41,480,288 bp
  • C to T, chromosome 4 at 42,792,546 bp
  • A to T, chromosome 4 at 65,156,189 bp
  • G to A, chromosome 4 at 98,945,211 bp
  • C to T, chromosome 4 at 126,316,839 bp
  • C to A, chromosome 4 at 130,174,030 bp
  • A to T, chromosome 4 at 136,329,426 bp
  • T to C, chromosome 4 at 155,418,664 bp
  • A to T, chromosome 5 at 45,774,174 bp
  • C to A, chromosome 5 at 109,220,027 bp
  • G to A, chromosome 5 at 114,248,754 bp
  • T to C, chromosome 6 at 42,486,969 bp
  • C to T, chromosome 6 at 124,532,540 bp
  • A to G, chromosome 7 at 22,163,371 bp
  • A to C, chromosome 7 at 26,267,752 bp
  • G to T, chromosome 7 at 85,872,696 bp
  • A to G, chromosome 7 at 107,823,421 bp
  • T to C, chromosome 7 at 119,659,102 bp
  • T to C, chromosome 7 at 141,324,165 bp
  • T to C, chromosome 8 at 48,342,653 bp
  • A to G, chromosome 8 at 71,367,044 bp
  • C to T, chromosome 8 at 106,257,426 bp
  • A to C, chromosome 8 at 117,042,298 bp
  • T to A, chromosome 9 at 15,599,844 bp
  • C to T, chromosome 9 at 95,406,294 bp
  • A to T, chromosome 9 at 96,687,047 bp
  • T to A, chromosome 9 at 108,828,952 bp
  • T to C, chromosome 10 at 24,037,912 bp
  • G to A, chromosome 10 at 79,548,440 bp
  • T to A, chromosome 10 at 93,733,604 bp
  • T to A, chromosome 10 at 106,819,359 bp
  • C to T, chromosome 10 at 127,503,585 bp
  • G to A, chromosome 11 at 51,048,111 bp
  • C to T, chromosome 11 at 53,990,838 bp
  • T to A, chromosome 11 at 58,447,383 bp
  • T to G, chromosome 11 at 69,396,322 bp
  • A to T, chromosome 11 at 71,123,909 bp
  • C to T, chromosome 11 at 98,388,006 bp
  • A to T, chromosome 11 at 99,603,140 bp
  • G to T, chromosome 13 at 21,388,213 bp
  • A to T, chromosome 13 at 52,967,573 bp
  • A to G, chromosome 13 at 66,905,299 bp
  • A to T, chromosome 14 at 55,718,456 bp
  • A to G, chromosome 14 at 55,741,181 bp
  • A to C, chromosome 14 at 61,204,543 bp
  • A to T, chromosome 14 at 80,018,167 bp
  • T to A, chromosome 14 at 103,685,755 bp
  • A to T, chromosome 14 at 118,611,750 bp
  • T to A, chromosome 15 at 5,010,927 bp
  • T to A, chromosome 15 at 6,772,129 bp
  • T to C, chromosome 15 at 8,327,124 bp
  • T to C, chromosome 15 at 76,176,032 bp
  • T to A, chromosome 15 at 84,787,362 bp
  • T to G, chromosome 15 at 98,588,612 bp
  • TAGGCACGGTCACCTGGCCTCCATATTCTCTCCCAGGCACGGTCACCTGGCCTCCACATTCTCCTCTAGGCACGGTCACCTGGCCTCCATATTCTCTCCCAGGCACGGTCACCTGGCCTCCAGATTCTCTTCCAGGCATGGTCACCTGGCCTCCATATTCTCTTCCAGGCACGGTCACCTGGCCTCCA to TAGGCACGGTCACCTGGCCTCCACATTCTCCTCTAGGCACGGTCACCTGGCCTCCATATTCTCTCCCAGGCACGGTCACCTGGCCTCCAGATTCTCTTCCAGGCATGGTCACCTGGCCTCCATATTCTCTTCCAGGCACGGTCACCTGGCCTCCA, chromosome 15 at 101,946,776 bp
  • G to C, chromosome 16 at 3,958,943 bp
  • T to A, chromosome 16 at 19,407,423 bp
  • A to T, chromosome 16 at 38,787,208 bp
  • C to A, chromosome 17 at 34,854,358 bp
  • T to G, chromosome 18 at 37,307,661 bp
  • T to C, chromosome 18 at 89,009,432 bp
  • G to T, chromosome 19 at 41,593,593 bp
  • A to T, chromosome 19 at 46,134,648 bp
  • T to A, chromosome Y at 1,434,993 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9008 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068838-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.