Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9014Btlr/Mmmh
Stock Number:
068844-MU
Citation ID:
RRID:MMRRC_068844-MU
Other Names:
R9014 (G1)
Major Collection:

Strain Information

Zdhhc17
Name: zinc finger, DHHC domain containing 17
Synonyms: A230053P19Rik, D130071N24Rik, Hip14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320150
VEGA: 10
Homologene: 56324
Ppp1r1b
Name: protein phosphatase 1, regulatory inhibitor subunit 1B
Synonyms: DARPP-32, Darpp32
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19049
HGNC: HGNC:9287
Homologene: 12972
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Arpp21
Name: cyclic AMP-regulated phosphoprotein, 21
Synonyms: ARPP-21, Tarpp, D9Bwg1012e, 0710001E13Rik, R3hdm3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74100
Homologene: 32306
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Aco2
Name: aconitase 2, mitochondrial
Synonyms: Aco3, Aco-2, D10Wsu183e, Irp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11429
HGNC: HGNC:118
Homologene: 856
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 60,289,959 bp
  • A to G, chromosome 1 at 75,132,630 bp
  • A to T, chromosome 1 at 111,860,779 bp
  • T to C, chromosome 1 at 135,003,510 bp
  • T to C, chromosome 1 at 172,179,963 bp
  • T to A, chromosome 1 at 172,210,497 bp
  • A to G, chromosome 1 at 175,698,829 bp
  • C to A, chromosome 2 at 82,976,554 bp
  • T to G, chromosome 2 at 82,986,731 bp
  • T to A, chromosome 2 at 86,958,691 bp
  • T to A, chromosome 2 at 109,293,069 bp
  • T to C, chromosome 3 at 87,751,172 bp
  • T to A, chromosome 3 at 133,467,188 bp
  • T to C, chromosome 3 at 144,736,970 bp
  • G to A, chromosome 4 at 86,821,465 bp
  • A to C, chromosome 4 at 86,836,429 bp
  • T to A, chromosome 4 at 88,357,526 bp
  • A to G, chromosome 4 at 112,625,829 bp
  • G to T, chromosome 5 at 89,132,386 bp
  • C to G, chromosome 5 at 128,602,305 bp
  • C to A, chromosome 5 at 150,541,754 bp
  • A to G, chromosome 6 at 18,853,633 bp
  • G to A, chromosome 6 at 23,970,050 bp
  • A to G, chromosome 6 at 70,960,831 bp
  • A to G, chromosome 6 at 89,654,109 bp
  • G to A, chromosome 6 at 89,894,015 bp
  • TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG, chromosome 6 at 99,075,905 bp
  • A to G, chromosome 6 at 119,317,258 bp
  • A to G, chromosome 7 at 28,155,451 bp
  • T to C, chromosome 7 at 29,206,641 bp
  • T to C, chromosome 7 at 39,537,822 bp
  • C to T, chromosome 7 at 44,209,674 bp
  • A to G, chromosome 7 at 101,404,333 bp
  • A to G, chromosome 7 at 108,565,675 bp
  • A to T, chromosome 7 at 140,465,970 bp
  • A to G, chromosome 8 at 22,940,071 bp
  • G to A, chromosome 8 at 84,721,776 bp
  • T to C, chromosome 9 at 37,646,343 bp
  • T to C, chromosome 9 at 38,594,827 bp
  • G to T, chromosome 9 at 112,177,728 bp
  • A to G, chromosome 9 at 121,188,228 bp
  • G to A, chromosome 10 at 7,919,156 bp
  • C to T, chromosome 10 at 106,927,805 bp
  • T to C, chromosome 10 at 110,949,683 bp
  • T to C, chromosome 10 at 127,183,738 bp
  • C to T, chromosome 11 at 30,986,158 bp
  • C to A, chromosome 11 at 52,118,683 bp
  • T to C, chromosome 11 at 78,269,662 bp
  • T to C, chromosome 11 at 98,350,623 bp
  • C to T, chromosome 11 at 120,272,889 bp
  • T to C, chromosome 11 at 120,282,222 bp
  • T to A, chromosome 12 at 53,139,620 bp
  • A to C, chromosome 12 at 69,196,651 bp
  • G to C, chromosome 12 at 100,913,064 bp
  • T to C, chromosome 12 at 112,773,736 bp
  • T to A, chromosome 12 at 114,788,413 bp
  • T to C, chromosome 13 at 38,192,724 bp
  • G to T, chromosome 13 at 51,127,974 bp
  • A to T, chromosome 13 at 67,592,155 bp
  • A to G, chromosome 14 at 53,717,147 bp
  • A to T, chromosome 14 at 103,585,139 bp
  • T to C, chromosome 15 at 4,899,188 bp
  • T to A, chromosome 15 at 79,620,757 bp
  • A to G, chromosome 15 at 81,914,656 bp
  • T to G, chromosome 16 at 18,259,650 bp
  • T to C, chromosome 16 at 79,075,803 bp
  • C to A, chromosome 17 at 35,882,598 bp
  • T to G, chromosome 17 at 40,207,796 bp
  • G to T, chromosome 18 at 34,221,021 bp
  • T to A, chromosome 19 at 6,322,259 bp
  • T to C, chromosome 19 at 11,301,507 bp
  • T to C, chromosome 19 at 37,687,396 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9014 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068844-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.