Strain Name:
C57BL/6J-MtgxR9014Btlr/Mmmh
Stock Number:
068844-MU
Citation ID:
RRID:MMRRC_068844-MU
Other Names:
R9014 (G1)
Major Collection:

Strain Information

Zdhhc17
Name: zinc finger, DHHC domain containing 17
Synonyms: D130071N24Rik, A230053P19Rik, Hip14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320150
VEGA: 10
Homologene: 56324
Ppp1r1b
Name: protein phosphatase 1, regulatory inhibitor subunit 1B
Synonyms: DARPP-32, Darpp32
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19049
HGNC: HGNC:9287
Homologene: 12972
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Arpp21
Name: cyclic AMP-regulated phosphoprotein, 21
Synonyms: ARPP-21, Tarpp, D9Bwg1012e, 0710001E13Rik, R3hdm3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74100
Homologene: 32306
Ccdc88c
Name: coiled-coil domain containing 88C
Synonyms: Daple, 0610010D24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 68339
VEGA: 12
Homologene: 18903
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Aco2
Name: aconitase 2, mitochondrial
Synonyms: Aco3, Aco-2, D10Wsu183e, Irp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11429
HGNC: HGNC:118
Homologene: 856
Dcaf8
Name: DDB1 and CUL4 associated factor 8
Synonyms: H326, D1Ucla4, D1Dau35e, Wdr42a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98193
Homologene: 56725
Ppp2ca
Name: protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform
Synonyms: PP2A
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19052
HGNC: HGNC:9299
Homologene: 37660
Zfp619
Name: zinc finger protein 619
Synonyms: 3000002G13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70227
Homologene: 133818
Tet2
Name: tet methylcytosine dioxygenase 2
Synonyms: E130014J05Rik, Ayu17-449
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214133
Homologene: 49498
Focad
Name: focadhesin
Synonyms: BC057079
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230393
Homologene: 9842
Kif18a
Name: kinesin family member 18A
Synonyms: N-8 kinesin, B130001M12Rik, gcd2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228421
Homologene: 41820
Dennd4c
Name: DENN domain containing 4C
Synonyms: 1700065A05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329877
Homologene: 23057
Txnrd3
Name: thioredoxin reductase 3
Synonyms: TR2, Tgr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232223
Homologene: 60033
Dhx16
Name: DEAH-box helicase 16
Synonyms: 2410006N22Rik, DBP2, Ddx16, DEAH (Asp-Glu-Ala-His) box polypeptide 16
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69192
HGNC: HGNC:2739
Homologene: 2658
Cdc42bpg
Name: CDC42 binding protein kinase gamma
Synonyms: MRCKgamma
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240505
Homologene: 28384
Fzd10
Name: frizzled class receptor 10
Synonyms: Fz-10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 93897
HGNC: HGNC:4039
Homologene: 21411
Dsp
Name: desmoplakin
Synonyms: DP, 2300002E22Rik, 5730453H04Rik, rul
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Nfix
Name: nuclear factor I/X
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18032
HGNC: HGNC:7788
Homologene: 1872
Lgr6
Name: leucine-rich repeat-containing G protein-coupled receptor 6
Synonyms: A530037C04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329252
Homologene: 49680
Ms4a14
Name: membrane-spanning 4-domains, subfamily A, member 14
Synonyms: LOC383435
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 383435
Homologene: 138453
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: Min, CC1, adenomatosis polyposis coli
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Spin1
Name: spindlin 1
Synonyms: Spin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20729
VEGA: 13
Homologene: 55983
Brca2
Name: breast cancer 2, early onset
Synonyms: RAB163, Fancd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12190
HGNC: HGNC:1101
Homologene: 41
Arap1
Name: ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1
Synonyms: 2410002L19Rik, Centd2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69710
Homologene: 12326
Dgcr8
Name: DGCR8, microprocessor complex subunit
Synonyms: N41, D16H22S788E, D16Wis2, Gy1, D16H22S1742E, Vo59c07, DiGeorge syndrome critical region gene 8
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 94223
HGNC: HGNC:2847
Homologene: 11223
Kat6a
Name: K(lysine) acetyltransferase 6A
Synonyms: MOZ, Zfp220, 9930021N24Rik, Myst3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244349
Homologene: 4924
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Slc4a4
Name: solute carrier family 4 (anion exchanger), member 4
Synonyms: NBC, NBC1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54403
Homologene: 55776
Pgk2
Name: phosphoglycerate kinase 2
Synonyms: Tcp-2, Tcp-2, Pgk-2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18663
VEGA: 17
HGNC: HGNC:8898
Homologene: 57138
Akap6
Name: A kinase anchor protein 6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238161
VEGA: 12
HGNC: HGNC:376
Homologene: 3157
Tab2
Name: TGF-beta activated kinase 1/MAP3K7 binding protein 2
Synonyms: Tak1 binding protein 2, 1110030N06Rik, A530078N03Rik, Map3k7ip2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68652
Homologene: 9019
Bltp2
Name: bridge-like lipid transfer protein family member 2
Synonyms: 2610507B11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72503
Homologene: 34730
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Ppfia2
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Synonyms: E130120L08Rik, Liprin-alpha2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 327814
VEGA: 10
HGNC: HGNC:9246
Homologene: 27953
Arhgef25
Name: Rho guanine nucleotide exchange factor 25
Synonyms: 2410008H17Rik, GEFT, D10Ertd610e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52666
VEGA: 10
Homologene: 32691
Fcgbpl1
Name: Fc fragment of IgG binding protein like 1
Synonyms: 9530053A07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319482
Homologene: 130055
Mroh2b
Name: maestro heat-like repeat family member 2B
Synonyms: 4930455B06Rik, Heatr7b2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223825
VEGA: 15
Homologene: 128807
Ahnak2
Name: AHNAK nucleoprotein 2
Synonyms: LOC382643
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100041194
Homologene: 131081
Casq1
Name: calsequestrin 1
Synonyms: CSQ-1, CSQ1, CSQ, sCSQ
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12372
HGNC: HGNC:1512
Homologene: 20329
Ulk4
Name: unc-51-like kinase 4
Synonyms: 4932415A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 209012
Homologene: 41205
Wdr64
Name: WD repeat domain 64
Synonyms: 4930415O10Rik, 4930511H01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75820
Homologene: 51634
Pear1
Name: platelet endothelial aggregation receptor 1
Synonyms: 3110045G13Rik, Jedi-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73182
Homologene: 12492
Skint2
Name: selection and upkeep of intraepithelial T cells 2
Synonyms: OTTMUSG00000008540, B7S3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329919
Homologene: 136741
Trav7-6
Name: T cell receptor alpha variable 7-6
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 213480
Fam227a
Name: family with sequence similarity 227, member A
Synonyms: 4933432B09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75729
Homologene: 123434
Tmprss15
Name: transmembrane protease, serine 15
Synonyms: enteropeptidase, enterokinase, A130097D21Rik, Prss7
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19146
HGNC: HGNC:9490
Homologene: 2075
Cyp26c1
Name: cytochrome P450, family 26, subfamily c, polypeptide 1
Synonyms: EG546726
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 546726
VEGA: 19
Homologene: 28089
Dsel
Name: dermatan sulfate epimerase-like
Synonyms: 9330132E09Rik, DS-epi2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319901
Homologene: 12964
Or8h9
Name: olfactory receptor family 8 subfamily H member 9
Synonyms: GA_x6K02T2Q125-48446067-48445129, MOR206-3, Olfr1099
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258764
Homologene: 107003
Tas2r118
Name: taste receptor, type 2, member 118
Synonyms: Tas2r18, mGR18, mt2r40, T2R18
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387347
Homologene: 9660
Klk1b4
Name: kallikrein 1-related pepidase b4
Synonyms: mGk-4, Ngfa, Ngfa
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18048
Homologene: 68141
Clca3a1
Name: chloride channel accessory 3A1
Synonyms: Clca1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12722
HGNC: HGNC:2017
Homologene: 77224
Or56b1b
Name: olfactory receptor family 56 subfamily B member 1B
Synonyms: GA_x6K02T2PBJ9-10895499-10894543, MOR40-7P, MOR40-15, Olfr504
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258163
Homologene: 17189
Catsperg1
Name: cation channel sperm associated auxiliary subunit gamma 1
Synonyms: A230107C01Rik, Catsperg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320225
Homologene: 10915
Scel
Name: sciellin
Synonyms: 9230114I02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64929
VEGA: 14
Homologene: 2850
Foxi3
Name: forkhead box I3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232077
Homologene: 52949
Lrtm2
Name: leucine-rich repeats and transmembrane domains 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211187
Homologene: 65244
Slc23a3
Name: solute carrier family 23 (nucleobase transporters), member 3
Synonyms: SVCT3, Yspl1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22626
Homologene: 65865
Siae
Name: sialic acid acetylesterase
Synonyms: LSE, clone 165, Ysg2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22619
Homologene: 8001
Or12j4
Name: olfactory receptor family 12 subfamily J member 4
Synonyms: GA_x6K02T2PBJ9-42615403-42616365, MOR252-3P, Olfr533
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258056
Homologene: 128384
Vmn1r44
Name: vomeronasal 1 receptor 44
Synonyms: V1rb4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113854
Homologene: 113975
Lsm8
Name: LSM8 homolog, U6 small nuclear RNA associated
Synonyms: 2010003I05Rik, Lsm8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76522
Homologene: 9419
Chac2
Name: ChaC, cation transport regulator 2
Synonyms: 2510006C20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68044
Homologene: 48696
Or8b49
Name: olfactory receptor family 8 subfamily B member 49
Synonyms: GA_x6K02T2PVTD-32296575-32297513, MOR165-9P, MOR165-10, Olfr913
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258225
VEGA: 9
Homologene: 79398
Ighv1-26
Name: immunoglobulin heavy variable 1-26
Synonyms: Gm16717
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 629884
Zfp729b
Name: zinc finger protein 729b
Synonyms: AA987161
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100416706
Homologene: 133713
Gm49383
Name: predicted gene, 49383
Type: Gene
Species: Mouse
Chromosome: 12
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 60,289,959 bp
  • A to G, chromosome 1 at 75,132,630 bp
  • A to T, chromosome 1 at 111,860,779 bp
  • T to C, chromosome 1 at 135,003,510 bp
  • T to C, chromosome 1 at 172,179,963 bp
  • T to A, chromosome 1 at 172,210,497 bp
  • A to G, chromosome 1 at 175,698,829 bp
  • C to A, chromosome 2 at 82,976,554 bp
  • T to G, chromosome 2 at 82,986,731 bp
  • T to A, chromosome 2 at 86,958,691 bp
  • T to A, chromosome 2 at 109,293,069 bp
  • T to C, chromosome 3 at 87,751,172 bp
  • T to A, chromosome 3 at 133,467,188 bp
  • T to C, chromosome 3 at 144,736,970 bp
  • G to A, chromosome 4 at 86,821,465 bp
  • A to C, chromosome 4 at 86,836,429 bp
  • T to A, chromosome 4 at 88,357,526 bp
  • A to G, chromosome 4 at 112,625,829 bp
  • G to T, chromosome 5 at 89,132,386 bp
  • C to G, chromosome 5 at 128,602,305 bp
  • C to A, chromosome 5 at 150,541,754 bp
  • A to G, chromosome 6 at 18,853,633 bp
  • G to A, chromosome 6 at 23,970,050 bp
  • A to G, chromosome 6 at 70,960,831 bp
  • A to G, chromosome 6 at 89,654,109 bp
  • G to A, chromosome 6 at 89,894,015 bp
  • TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG, chromosome 6 at 99,075,905 bp
  • A to G, chromosome 6 at 119,317,258 bp
  • A to G, chromosome 7 at 28,155,451 bp
  • T to C, chromosome 7 at 29,206,641 bp
  • T to C, chromosome 7 at 39,537,822 bp
  • C to T, chromosome 7 at 44,209,674 bp
  • A to G, chromosome 7 at 101,404,333 bp
  • A to G, chromosome 7 at 108,565,675 bp
  • A to T, chromosome 7 at 140,465,970 bp
  • A to G, chromosome 8 at 22,940,071 bp
  • G to A, chromosome 8 at 84,721,776 bp
  • T to C, chromosome 9 at 37,646,343 bp
  • T to C, chromosome 9 at 38,594,827 bp
  • G to T, chromosome 9 at 112,177,728 bp
  • A to G, chromosome 9 at 121,188,228 bp
  • G to A, chromosome 10 at 7,919,156 bp
  • C to T, chromosome 10 at 106,927,805 bp
  • T to C, chromosome 10 at 110,949,683 bp
  • T to C, chromosome 10 at 127,183,738 bp
  • C to T, chromosome 11 at 30,986,158 bp
  • C to A, chromosome 11 at 52,118,683 bp
  • T to C, chromosome 11 at 78,269,662 bp
  • T to C, chromosome 11 at 98,350,623 bp
  • C to T, chromosome 11 at 120,272,889 bp
  • T to C, chromosome 11 at 120,282,222 bp
  • T to A, chromosome 12 at 53,139,620 bp
  • A to C, chromosome 12 at 69,196,651 bp
  • G to C, chromosome 12 at 100,913,064 bp
  • T to C, chromosome 12 at 112,773,736 bp
  • T to A, chromosome 12 at 114,788,413 bp
  • T to C, chromosome 13 at 38,192,724 bp
  • G to T, chromosome 13 at 51,127,974 bp
  • A to T, chromosome 13 at 67,592,155 bp
  • A to G, chromosome 14 at 53,717,147 bp
  • A to T, chromosome 14 at 103,585,139 bp
  • T to C, chromosome 15 at 4,899,188 bp
  • T to A, chromosome 15 at 79,620,757 bp
  • A to G, chromosome 15 at 81,914,656 bp
  • T to G, chromosome 16 at 18,259,650 bp
  • T to C, chromosome 16 at 79,075,803 bp
  • C to A, chromosome 17 at 35,882,598 bp
  • T to G, chromosome 17 at 40,207,796 bp
  • G to T, chromosome 18 at 34,221,021 bp
  • T to A, chromosome 19 at 6,322,259 bp
  • T to C, chromosome 19 at 11,301,507 bp
  • T to C, chromosome 19 at 37,687,396 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9014 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068844-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.