Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9025Btlr/Mmmh
Stock Number:
068854-MU
Citation ID:
RRID:MMRRC_068854-MU
Other Names:
R9025 (G1)
Major Collection:

Strain Information

Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: D0Jmb2, E030044M24Rik, NMHC II-A, Myhn-1, Myhn1, myosin IIA, Fltn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Scarb1
Name: scavenger receptor class B, member 1
Synonyms: D5Ertd460e, Srb1, Cd36l1, Cla-1, SRBI, SR-BI, Hlb398, Hdlq1, Chohd1, Chohd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20778
HGNC: HGNC:1664
Homologene: 21132
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Eif3g
Name: eukaryotic translation initiation factor 3, subunit G
Synonyms: TU-189B2, p44, 44kDa, D0Jmb4, Eif3s4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53356
VEGA: 9
HGNC: HGNC:3274
Homologene: 2784
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Nedd4l
Name: neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms: 1300012C07Rik, Nedd4-2, Nedd4b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 83814
VEGA: 18
HGNC: HGNC:7728
Homologene: 86986
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 33,746,824 bp
  • T to A, chromosome 1 at 34,188,504 bp
  • A to G, chromosome 1 at 127,830,438 bp
  • T to A, chromosome 1 at 133,285,261 bp
  • G to A, chromosome 2 at 11,718,422 bp
  • A to G, chromosome 2 at 31,457,955 bp
  • G to A, chromosome 2 at 80,349,293 bp
  • T to G, chromosome 2 at 85,759,535 bp
  • A to G, chromosome 2 at 122,173,290 bp
  • T to C, chromosome 2 at 144,476,092 bp
  • G to A, chromosome 2 at 156,068,504 bp
  • G to A, chromosome 2 at 178,462,616 bp
  • T to A, chromosome 4 at 46,607,062 bp
  • T to C, chromosome 4 at 152,407,178 bp
  • A to T, chromosome 5 at 125,304,350 bp
  • T to A, chromosome 5 at 139,356,715 bp
  • A to T, chromosome 5 at 150,295,808 bp
  • G to T, chromosome 6 at 128,557,582 bp
  • A to G, chromosome 7 at 13,303,820 bp
  • A to T, chromosome 7 at 14,491,830 bp
  • G to A, chromosome 7 at 25,384,498 bp
  • A to T, chromosome 7 at 46,197,190 bp
  • A to G, chromosome 7 at 46,288,096 bp
  • C to T, chromosome 7 at 46,851,009 bp
  • G to A, chromosome 7 at 113,351,824 bp
  • T to A, chromosome 7 at 126,586,457 bp
  • C to T, chromosome 7 at 133,717,617 bp
  • T to C, chromosome 7 at 137,312,369 bp
  • G to T, chromosome 7 at 141,872,472 bp
  • A to G, chromosome 8 at 27,154,708 bp
  • A to T, chromosome 8 at 55,872,161 bp
  • C to T, chromosome 8 at 69,864,447 bp
  • T to A, chromosome 8 at 95,749,032 bp
  • A to T, chromosome 9 at 7,139,462 bp
  • T to C, chromosome 9 at 20,896,130 bp
  • C to A, chromosome 9 at 48,592,161 bp
  • A to G, chromosome 9 at 57,702,787 bp
  • C to A, chromosome 9 at 78,442,505 bp
  • C to A, chromosome 9 at 90,185,795 bp
  • A to G, chromosome 9 at 109,073,838 bp
  • A to G, chromosome 9 at 110,422,383 bp
  • T to C, chromosome 10 at 26,984,371 bp
  • C to G, chromosome 10 at 80,357,996 bp
  • T to A, chromosome 10 at 85,882,881 bp
  • T to C, chromosome 10 at 107,777,571 bp
  • T to C, chromosome 11 at 66,005,825 bp
  • T to C, chromosome 11 at 69,122,956 bp
  • C to T, chromosome 11 at 72,437,297 bp
  • T to G, chromosome 11 at 101,262,815 bp
  • GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG to GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG, chromosome 11 at 116,457,541 bp
  • A to G, chromosome 12 at 81,772,733 bp
  • A to G, chromosome 12 at 104,340,971 bp
  • T to A, chromosome 13 at 46,684,233 bp
  • T to C, chromosome 14 at 24,149,478 bp
  • C to T, chromosome 14 at 24,469,411 bp
  • C to A, chromosome 14 at 30,002,900 bp
  • T to C, chromosome 14 at 34,195,000 bp
  • T to C, chromosome 14 at 75,084,844 bp
  • G to T, chromosome 15 at 28,409,266 bp
  • T to C, chromosome 15 at 75,867,204 bp
  • T to C, chromosome 15 at 76,002,333 bp
  • T to A, chromosome 15 at 76,106,303 bp
  • T to A, chromosome 15 at 76,303,217 bp
  • T to C, chromosome 15 at 77,768,992 bp
  • A to T, chromosome 15 at 78,430,082 bp
  • T to A, chromosome 15 at 81,007,981 bp
  • A to G, chromosome 17 at 21,992,340 bp
  • T to C, chromosome 17 at 23,669,888 bp
  • G to A, chromosome 17 at 27,118,677 bp
  • T to A, chromosome 17 at 34,214,261 bp
  • A to G, chromosome 17 at 34,600,620 bp
  • T to C, chromosome 17 at 56,566,614 bp
  • T to A, chromosome 17 at 56,655,156 bp
  • T to A, chromosome 17 at 67,812,496 bp
  • T to C, chromosome 18 at 36,686,837 bp
  • T to C, chromosome 18 at 39,246,845 bp
  • T to A, chromosome 18 at 65,178,924 bp
  • T to C, chromosome 18 at 67,634,815 bp
  • G to A, chromosome 19 at 6,061,639 bp
  • G to A, chromosome 19 at 6,213,397 bp
  • A to T, chromosome 19 at 10,860,161 bp
  • A to G, chromosome 19 at 18,639,792 bp
  • T to A, chromosome 19 at 41,624,529 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9025 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068854-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.