Strain Name:
C57BL/6J-MtgxR9025Btlr/Mmmh
Stock Number:
068854-MU
Citation ID:
RRID:MMRRC_068854-MU
Other Names:
R9025 (G1)
Major Collection:

Strain Information

Myh9
Name: myosin, heavy polypeptide 9, non-muscle
Synonyms: D0Jmb2, Fltn, Myhn1, Myhn-1, E030044M24Rik, NMHC II-A, myosin IIA
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17886
HGNC: HGNC:7579
Homologene: 129835
Scarb1
Name: scavenger receptor class B, member 1
Synonyms: D5Ertd460e, Srb1, Cd36l1, Cla-1, SRBI, SR-BI, Hlb398, Hdlq1, Chohd1, Chohd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20778
HGNC: HGNC:1664
Homologene: 21132
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Dst
Name: dystonin
Synonyms: A830042E19Rik, nmf203, bullous pemphigoid antigen 1, BPAG1-n, Bpag, Bpag1, BPAG1, 2310001O04Rik, nmf339, Macf2, ah, bullous pemphigoid antigen 1, athetoid
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Eif3g
Name: eukaryotic translation initiation factor 3, subunit G
Synonyms: p44, Eif3s4, D0Jmb4, 44kDa, TU-189B2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53356
VEGA: 9
HGNC: HGNC:3274
Homologene: 2784
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Nedd4l
Name: neural precursor cell expressed, developmentally down-regulated gene 4-like
Synonyms: Nedd4b, Nedd4-2, 1300012C07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 83814
VEGA: 18
HGNC: HGNC:7728
Homologene: 86986
Polr3a
Name: polymerase (RNA) III (DNA directed) polypeptide A
Synonyms: RPC1, 9330175N20Rik, RPC155
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218832
VEGA: 14
Homologene: 5124
Cnot1
Name: CCR4-NOT transcription complex, subunit 1
Synonyms: 6030411K04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234594
HGNC: HGNC:7877
Homologene: 9453
Safb2
Name: scaffold attachment factor B2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224902
Homologene: 35210
Fam83h
Name: family with sequence similarity 83, member H
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105732
VEGA: 15
Homologene: 15890
Kctd17
Name: potassium channel tetramerisation domain containing 17
Synonyms: 2900008M13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72844
Homologene: 23468
Pwp1
Name: PWP1 homolog, endonuclein
Synonyms: 2310058A11Rik, 2610205J09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103136
Homologene: 5129
Il15ra
Name: interleukin 15 receptor, alpha chain
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16169
HGNC: HGNC:5978
Homologene: 1650
Dnajc10
Name: DnaJ heat shock protein family (Hsp40) member C10
Synonyms: D2Ertd706e, JPDI, 1200006L06Rik, ERdj5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66861
Homologene: 10358
Cyp1a1
Name: cytochrome P450, family 1, subfamily a, polypeptide 1
Synonyms: cytochrome P450 subfamily I, polypeptide 1, P450-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13076
VEGA: 9
HGNC: HGNC:2595
Homologene: 68062
Ebf3
Name: early B cell factor 3
Synonyms: Olf-1/EBF-like 2, O/E-2, 3110018A08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13593
Homologene: 56472
Il17rb
Name: interleukin 17 receptor B
Synonyms: Il17br, Evi27, IL-17Rh1, IL-17ER, IL17RH1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50905
Homologene: 10287
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: 4432416O06Rik, b2b414Clo, D030010H02Rik, DHC2, Dnchc2, D330044F14Rik, m152Asp, DHC1b, m407Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Bccip
Name: BRCA2 and CDKN1A interacting protein
Synonyms: TOK-1, 1110013J05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66165
HGNC: HGNC:978
Homologene: 41629
Btbd10
Name: BTB domain containing 10
Synonyms: Gmrp1, 1110056N09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68815
Homologene: 13009
Cep76
Name: centrosomal protein 76
Synonyms: 6230425F05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225659
VEGA: 18
Homologene: 11774
Atrip
Name: ATR interacting protein
Synonyms: 6620401K05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235610
Homologene: 15601
Nup153
Name: nucleoporin 153
Synonyms: B130015D15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218210
HGNC: HGNC:8062
Homologene: 68442
Tbc1d2
Name: TBC1 domain family, member 2
Synonyms: LOC381605, PARIS-1, PARIS1, A630005A06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381605
Homologene: 10190
Thoc6
Name: THO complex 6
Synonyms: F830014G06Rik, Wdr58
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 386612
Homologene: 11533
Itpr3
Name: inositol 1,4,5-triphosphate receptor 3
Synonyms: tf, Ip3r3, Itpr-3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16440
HGNC: HGNC:6182
Homologene: 1675
Hmcn2
Name: hemicentin 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 665700
Homologene: 90772
Lig1
Name: ligase I, DNA, ATP-dependent
Synonyms: mLigI, LigI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16881
HGNC: HGNC:6598
Homologene: 197
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Dnahc5, b2b1565Clo, b2b3491Clo, b2b1134Clo, b2b1537Clo, Mdnah5, b2b1154Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Trim69
Name: tripartite motif-containing 69
Synonyms: 4921519C19Rik, Trif, Rnf36
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70928
Homologene: 18827
Zfp943
Name: zinc finger prtoein 943
Synonyms: 4930432O21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74670
Homologene: 134342
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: Dnahc9, D11Ertd686e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Gm15821
Name: predicted gene 15821
Type: Gene
Species: Mouse
Chromosome: 17
Oplah
Name: 5-oxoprolinase (ATP-hydrolysing)
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75475
HGNC: HGNC:8149
Homologene: 90938
Adamts7
Name: ADAM metallopeptidase with thrombospondin type 1 motif 7
Synonyms: ADAM-TS7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108153
HGNC: HGNC:223
Homologene: 22803
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Rab11fip1
Name: RAB11 family interacting protein 1 (class I)
Synonyms: 2010200K21Rik, 4833414G05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75767
Homologene: 11853
A2ml1
Name: alpha-2-macroglobulin like 1
Synonyms: BC048546, Ovos2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232400
Homologene: 45969
Lipe
Name: lipase, hormone sensitive
Synonyms: HSL, 4933403G17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16890
HGNC: HGNC:6621
Homologene: 3912
Wnk4
Name: WNK lysine deficient protein kinase 4
Synonyms: 2010002J11Rik, Prkwnk4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69847
Homologene: 13020
Ggt6
Name: gamma-glutamyltransferase 6
Synonyms: 9030405D14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71522
Homologene: 51918
Otogl
Name: otogelin-like
Synonyms: Gm6924
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 628870
Homologene: 46008
Ush1c
Name: USH1 protein network component harmonin
Synonyms: 2010016F01Rik, harmonin, Usher syndrome 1C
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72088
Homologene: 77476
E230025N22Rik
Name: Riken cDNA E230025N22 gene
Synonyms: EG240216
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240216
Homologene: 131194
Plekha6
Name: pleckstrin homology domain containing, family A member 6
Synonyms: Pepp3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240753
Homologene: 135779
Nmrk1
Name: nicotinamide riboside kinase 1
Synonyms: BC016495, D630020N23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225994
Homologene: 6787
Sgsm3
Name: small G protein signaling modulator 3
Synonyms: 1810012I01Rik, CIP85, Rutbc3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105835
Homologene: 9249
Qrich2
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217341
Homologene: 12951
Dlg5
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71228
HGNC: HGNC:2904
Homologene: 3486
Map3k19
Name: mitogen-activated protein kinase kinase kinase 19
Synonyms: Ysk4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22625
Homologene: 19318
Spag4
Name: sperm associated antigen 4
Synonyms: 1700041K21Rik, Sun4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 245865
Homologene: 2343
Ngp
Name: neutrophilic granule protein
Synonyms: bectenecin, myeloid granule protein, clone B6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18054
Homologene: 49180
Nnmt
Name: nicotinamide N-methyltransferase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18113
HGNC: HGNC:7861
Homologene: 4496
Cdh26
Name: cadherin-like 26
Synonyms: LOC381409
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381409
Homologene: 18643
Arhgap26
Name: Rho GTPase activating protein 26
Synonyms: 2610010G17Rik, 1810044B20Rik, 4933432P15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71302
Homologene: 36349
Adam29
Name: a disintegrin and metallopeptidase domain 29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244486
HGNC: HGNC:207
Homologene: 8607
Cgas
Name: cyclic GMP-AMP synthase
Synonyms: E330016A19Rik, Mb21d1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214763
Homologene: 51384
Dzank1
Name: double zinc ribbon and ankyrin repeat domains 1
Synonyms: 2810039F03Rik, 6330439K17Rik, Ankrd64
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241688
Homologene: 10037
Catsperd
Name: cation channel sperm associated auxiliary subunit delta
Synonyms: 4921529N20Rik, Gm6095, 4933402B14Rik, Tmem146
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106757
VEGA: 17
Homologene: 51896
Lrrc63
Name: leucine rich repeat containing 63
Synonyms: 4921509B22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70859
Homologene: 52823
Or9g3
Name: olfactory receptor family 9 subfamily G member 3
Synonyms: GA_x6K02T2Q125-47239120-47238185, MOR213-6, Olfr1012
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258561
Homologene: 64889
Kcnab2
Name: potassium voltage-gated channel, shaker-related subfamily, beta member 2
Synonyms: Kcnb3, I2rf5, F5, I2rf5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16498
HGNC: HGNC:6229
Homologene: 56492
Majin
Name: membrane anchored junction protein
Synonyms: 1700123I01Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 622554
Homologene: 78163
Pbx4
Name: pre B cell leukemia homeobox 4
Synonyms: 2410015M21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 80720
Homologene: 57027
Tmem132a
Name: transmembrane protein 132A
Synonyms: 6720481D13Rik, Hspa5bp1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 98170
Homologene: 75076
Ldha
Name: lactate dehydrogenase A
Synonyms: lactate dehydrogenase-A, LDH-A, l7R2, Ldh-1, Ldh1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16828
HGNC: HGNC:6535
Homologene: 56495
Map3k9
Name: mitogen-activated protein kinase kinase kinase 9
Synonyms: Mlk1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 338372
VEGA: 12
HGNC: HGNC:6861
Homologene: 76377
Bag2
Name: BCL2-associated athanogene 2
Synonyms: 2610042A13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213539
HGNC: HGNC:938
Homologene: 31233
Plk5
Name: polo like kinase 5
Synonyms: 6330514A18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216166
Homologene: 28072
Apobr
Name: apolipoprotein B receptor
Synonyms: Apob-48r, Apob48r
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171504
Homologene: 26695
Gsdmd
Name: gasdermin D
Synonyms: M2-4, DF5L, Dfna5l, Gsdmdc1, 1810036L03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69146
VEGA: 15
Homologene: 12299
Cyp2w1
Name: cytochrome P450, family 2, subfamily w, polypeptide 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 545817
Homologene: 69239
Serpina3k
Name: serine (or cysteine) peptidase inhibitor, clade A, member 3K
Synonyms: contrapsin, Spi-2, D12Rp54, RP54, Spi2, MMSpi2, MMCM2, alpha-1 antiproteinase, 1300001I07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20714
HGNC: HGNC:16
Homologene: 111129
Znhit2
Name: zinc finger, HIT domain containing 2
Synonyms: ORF6, Znhit2-ps
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 29805
HGNC: HGNC:1177
Homologene: 8477
Ager
Name: advanced glycosylation end product-specific receptor
Synonyms: RAGE
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11596
HGNC: HGNC:320
Homologene: 883
Gprin2
Name: G protein regulated inducer of neurite outgrowth 2
Synonyms: C130040D06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 432839
VEGA: 14
Homologene: 40975
Sult2a7
Name: sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 7
Synonyms: Gm7231
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 638251
Hes7
Name: hes family bHLH transcription factor 7
Synonyms: bHLHb37
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 84653
Homologene: 23779
Eppk1
Name: epiplakin 1
Synonyms: EPIPL1, EPPK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223650
VEGA: 15
Homologene: 20006
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 33,746,824 bp
  • T to A, chromosome 1 at 34,188,504 bp
  • A to G, chromosome 1 at 127,830,438 bp
  • T to A, chromosome 1 at 133,285,261 bp
  • G to A, chromosome 2 at 11,718,422 bp
  • A to G, chromosome 2 at 31,457,955 bp
  • G to A, chromosome 2 at 80,349,293 bp
  • T to G, chromosome 2 at 85,759,535 bp
  • A to G, chromosome 2 at 122,173,290 bp
  • T to C, chromosome 2 at 144,476,092 bp
  • G to A, chromosome 2 at 156,068,504 bp
  • G to A, chromosome 2 at 178,462,616 bp
  • T to A, chromosome 4 at 46,607,062 bp
  • T to C, chromosome 4 at 152,407,178 bp
  • A to T, chromosome 5 at 125,304,350 bp
  • T to A, chromosome 5 at 139,356,715 bp
  • A to T, chromosome 5 at 150,295,808 bp
  • G to T, chromosome 6 at 128,557,582 bp
  • A to G, chromosome 7 at 13,303,820 bp
  • A to T, chromosome 7 at 14,491,830 bp
  • G to A, chromosome 7 at 25,384,498 bp
  • A to T, chromosome 7 at 46,197,190 bp
  • A to G, chromosome 7 at 46,288,096 bp
  • C to T, chromosome 7 at 46,851,009 bp
  • G to A, chromosome 7 at 113,351,824 bp
  • T to A, chromosome 7 at 126,586,457 bp
  • C to T, chromosome 7 at 133,717,617 bp
  • T to C, chromosome 7 at 137,312,369 bp
  • G to T, chromosome 7 at 141,872,472 bp
  • A to G, chromosome 8 at 27,154,708 bp
  • A to T, chromosome 8 at 55,872,161 bp
  • C to T, chromosome 8 at 69,864,447 bp
  • T to A, chromosome 8 at 95,749,032 bp
  • A to T, chromosome 9 at 7,139,462 bp
  • T to C, chromosome 9 at 20,896,130 bp
  • C to A, chromosome 9 at 48,592,161 bp
  • A to G, chromosome 9 at 57,702,787 bp
  • C to A, chromosome 9 at 78,442,505 bp
  • C to A, chromosome 9 at 90,185,795 bp
  • A to G, chromosome 9 at 109,073,838 bp
  • A to G, chromosome 9 at 110,422,383 bp
  • T to C, chromosome 10 at 26,984,371 bp
  • C to G, chromosome 10 at 80,357,996 bp
  • T to A, chromosome 10 at 85,882,881 bp
  • T to C, chromosome 10 at 107,777,571 bp
  • T to C, chromosome 11 at 66,005,825 bp
  • T to C, chromosome 11 at 69,122,956 bp
  • C to T, chromosome 11 at 72,437,297 bp
  • T to G, chromosome 11 at 101,262,815 bp
  • GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG to GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG, chromosome 11 at 116,457,541 bp
  • A to G, chromosome 12 at 81,772,733 bp
  • A to G, chromosome 12 at 104,340,971 bp
  • T to A, chromosome 13 at 46,684,233 bp
  • T to C, chromosome 14 at 24,149,478 bp
  • C to T, chromosome 14 at 24,469,411 bp
  • C to A, chromosome 14 at 30,002,900 bp
  • T to C, chromosome 14 at 34,195,000 bp
  • T to C, chromosome 14 at 75,084,844 bp
  • G to T, chromosome 15 at 28,409,266 bp
  • T to C, chromosome 15 at 75,867,204 bp
  • T to C, chromosome 15 at 76,002,333 bp
  • T to A, chromosome 15 at 76,106,303 bp
  • T to A, chromosome 15 at 76,303,217 bp
  • T to C, chromosome 15 at 77,768,992 bp
  • A to T, chromosome 15 at 78,430,082 bp
  • T to A, chromosome 15 at 81,007,981 bp
  • A to G, chromosome 17 at 21,992,340 bp
  • T to C, chromosome 17 at 23,669,888 bp
  • G to A, chromosome 17 at 27,118,677 bp
  • T to A, chromosome 17 at 34,214,261 bp
  • A to G, chromosome 17 at 34,600,620 bp
  • T to C, chromosome 17 at 56,566,614 bp
  • T to A, chromosome 17 at 56,655,156 bp
  • T to A, chromosome 17 at 67,812,496 bp
  • T to C, chromosome 18 at 36,686,837 bp
  • T to C, chromosome 18 at 39,246,845 bp
  • T to A, chromosome 18 at 65,178,924 bp
  • T to C, chromosome 18 at 67,634,815 bp
  • G to A, chromosome 19 at 6,061,639 bp
  • G to A, chromosome 19 at 6,213,397 bp
  • A to T, chromosome 19 at 10,860,161 bp
  • A to G, chromosome 19 at 18,639,792 bp
  • T to A, chromosome 19 at 41,624,529 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9025 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068854-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.