Strain Name:
C57BL/6J-MtgxR9035Btlr/Mmmh
Stock Number:
068864-MU
Citation ID:
RRID:MMRRC_068864-MU
Other Names:
R9035 (G1)
Major Collection:

Strain Information

Ednrb
Name: endothelin receptor type B
Synonyms: ETb, ETR-b, Sox10m1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13618
VEGA: 14
HGNC: HGNC:3180
Homologene: 89
Kifc3
Name: kinesin family member C3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16582
HGNC: HGNC:6326
Homologene: 124421
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Trmt9b
Name: tRNA methyltransferase 9B
Synonyms: 6430573F11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319582
Homologene: 35306
Plg
Name: plasminogen
Synonyms: Pg
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18815
VEGA: 17
HGNC: HGNC:9071
Homologene: 55452
Prss12
Name: serine protease 12 neurotrypsin (motopsin)
Synonyms: Bssp-3, motopsin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19142
HGNC: HGNC:9477
Homologene: 7490
Nsd1
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Clasp1
Name: CLIP associating protein 1
Synonyms: mCLASP1, 5730583A19Rik, 1700030C23Rik, B130045P17Rik, CLASP1alpha, CLASP1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76707
Homologene: 41024
Ift70b
Name: intraflagellar transport 70B
Synonyms: Ttc30b, 2510042P03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72421
Homologene: 71716
Cnst
Name: consortin, connexin sorting protein
Synonyms: 9630058J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226744
Homologene: 17139
L3mbtl2
Name: L3MBTL2 polycomb repressive complex 1 subunit
Synonyms: 4732493N06Rik, m4mbt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 214669
Homologene: 12882
Usp30
Name: ubiquitin specific peptidase 30
Synonyms: D5Ertd483e, 6330590F17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100756
Homologene: 32789
Sin3b
Name: transcriptional regulator, SIN3B (yeast)
Synonyms: 2810430C10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20467
Homologene: 81810
Cep104
Name: centrosomal protein 104
Synonyms: BC046331
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230967
Homologene: 44919
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: Bat2d, Bat2l2, 9630039I18Rik, 1810043M20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Bptf
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207165
HGNC: HGNC:3581
Homologene: 114397
Chaf1a
Name: chromatin assembly factor 1, subunit A
Synonyms: p150, CAF-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27221
VEGA: 17
HGNC: HGNC:1910
Homologene: 4003
Slc30a6
Name: solute carrier family 30 (zinc transporter), member 6
Synonyms: ZnT-6, ZnT6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210148
VEGA: 17
Homologene: 32380
Xdh
Name: xanthine dehydrogenase
Synonyms: Xox1, Xox-1, xanthine oxidase, Xor, XO
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22436
VEGA: 17
Homologene: 324
Tmem245
Name: transmembrane protein 245
Synonyms: D730040F13Rik, A630051L19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242474
HGNC: HGNC:1363
Homologene: 41841
Scp2
Name: sterol carrier protein 2, liver
Synonyms: ns-LTP, NSL-TP, nonspecific lipid transfer protein, SCP-2, SCPx
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20280
Homologene: 37717
Atg16l1
Name: autophagy related 16 like 1
Synonyms: APG16L, 1500009K01Rik, WDR30
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77040
Homologene: 41786
Trappc10
Name: trafficking protein particle complex 10
Synonyms: b2b2613Clo, Tmem1, LOC380642, b2b2416Clo, B230307C21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216131
VEGA: 10
Homologene: 37751
Cdhr1
Name: cadherin-related family member 1
Synonyms: Prcad, Pcdh21
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 170677
VEGA: 14
Homologene: 13215
Camta1
Name: calmodulin binding transcription activator 1
Synonyms: 2310058O09Rik, 1810059M14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100072
Homologene: 18942
Sf3b4
Name: splicing factor 3b, subunit 4
Synonyms: Sap49, 49kDa, SF3b49
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 107701
Homologene: 134086
Dolk
Name: dolichol kinase
Synonyms: Tmem15
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227697
Homologene: 8940
Anxa7
Name: annexin A7
Synonyms: Anx7, synexin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11750
VEGA: 14
HGNC: HGNC:545
Homologene: 36149
Tpm1
Name: tropomyosin 1, alpha
Synonyms: alpha-TM, Tpm-1, Tm3, TM2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22003
Homologene: 128637
Cenpe
Name: centromere protein E
Synonyms: CENP-E, Kif10, 312kDa, N-7 kinesin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229841
HGNC: HGNC:1856
Homologene: 20429
Med19
Name: mediator complex subunit 19
Synonyms: LCMR1, 2410018M14Rik, 3110040A13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381379
Homologene: 14684
Edrf1
Name: erythroid differentiation regulatory factor 1
Synonyms: 2700050L05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 214764
Homologene: 27985
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: skrr, Ryr, calcium release channel isoform 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Ctnnd2
Name: catenin delta 2
Synonyms: Nprap, catenin (cadherin associated protein), delta 2, Catnd2, neurojugin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18163
VEGA: 15
HGNC: HGNC:2516
Homologene: 55574
Nobox
Name: NOBOX oogenesis homeobox
Synonyms: Og2x
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18291
Homologene: 51066
Slfn4
Name: schlafen 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20558
Homologene: 133236
Nacc2
Name: nucleus accumbens associated 2, BEN and BTB (POZ) domain containing
Synonyms: 0610020I02Rik, Btbd14a, C030048H19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67991
Homologene: 75239
Epha5
Name: Eph receptor A5
Synonyms: bsk, Hek7, Rek7, Ehk1, Els1, Cek7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13839
HGNC: HGNC:3389
Homologene: 55824
Usp2
Name: ubiquitin specific peptidase 2
Synonyms: B930035K21Rik, ubp41
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53376
Homologene: 3098
Ttn
Name: titin
Synonyms: connectin, shru, D330041I19Rik, 2310057K23Rik, mdm, D830007G01Rik, 2310074I15Rik, 1100001C23Rik, 2310036G12Rik, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Nlgn1
Name: neuroligin 1
Synonyms: NL1, Nlg1, 6330415N05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192167
Homologene: 56690
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Pico, Acz
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Pkhd1
Name: polycystic kidney and hepatic disease 1
Synonyms: tigmin, FPC
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241035
HGNC: HGNC:9016
Homologene: 16336
Fat2
Name: FAT atypical cadherin 2
Synonyms: EMI2, Fath2, mKIAA0811, LOC245827
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Myo1g
Name: myosin IG
Synonyms: E430002D17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246177
Homologene: 27996
Vmn2r2
Name: vomeronasal 2, receptor 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100125586
Homologene: 129753
Grm3
Name: glutamate receptor, metabotropic 3
Synonyms: mGlu3, Gprc1c, 0710001G23Rik, mGluR3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108069
HGNC: HGNC:4595
Homologene: 651
Or8k33
Name: olfactory receptor family 8 subfamily K member 33
Synonyms: GA_x6K02T2Q125-48039418-48038477, Olfr1080, MOR192-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258404
Homologene: 104285
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381522
Homologene: 117988
Abca9
Name: ATP-binding cassette, sub-family A member 9
Synonyms: D630040K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217262
HGNC: HGNC:39
Homologene: 33332
Dll1
Name: delta like canonical Notch ligand 1
Synonyms: Delta1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13388
HGNC: HGNC:2908
Homologene: 4104
Slc15a2
Name: solute carrier family 15 (H+/peptide transporter), member 2
Synonyms: 8430408C16Rik, Pept2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 57738
Homologene: 56912
Vmn2r85
Name: vomeronasal 2, receptor 85
Synonyms: EG623734
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 623734
Homologene: 129606
Dnai4
Name: dynein axonemal intermediate chain 4
Synonyms: Wdr78
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242584
Homologene: 11702
Zfp623
Name: zinc finger protein 623
Synonyms: 2610029D06Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78834
VEGA: 15
Homologene: 15994
Fbxw10
Name: F-box and WD-40 domain protein 10
Synonyms: SM25H2, SM2SH2, Fbw10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 213980
Homologene: 32757
Mkrn2
Name: makorin, ring finger protein, 2
Synonyms: 2610002L04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67027
HGNC: HGNC:7113
Homologene: 8392
Nt5e
Name: 5' nucleotidase, ecto
Synonyms: CD73, ecto-5'-nucleotidase, 2210401F01Rik, Nt5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23959
HGNC: HGNC:8021
Homologene: 1895
Tlr11
Name: toll-like receptor 11
Synonyms: LOC239081
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239081
Homologene: 77905
Gmip
Name: Gem-interacting protein
Synonyms: 5031419I10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 78816
Homologene: 9570
Mgarp
Name: mitochondria localized glutamic acid rich protein
Synonyms: 4930583H14Rik, Osap
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67749
Homologene: 49858
Slc45a3
Name: solute carrier family 45, member 3
Synonyms: IPCA-6, 2210413P12Rik, Pcanap6
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 212980
HGNC: HGNC:8642
Homologene: 23813
Cabs1
Name: calcium binding protein, spermatid specific 1
Synonyms: 4931407G18Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70977
Homologene: 13225
Olfm5
Name: olfactomedin 5
Synonyms: E030002O03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244180
Homologene: 18253
Clnk
Name: cytokine-dependent hematopoietic cell linker
Synonyms: MIST
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27278
Homologene: 8450
Mucl2
Name: mucin-like 2
Synonyms: Spt-1, Spt1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20770
Homologene: 137219
Tgs1
Name: trimethylguanosine synthase 1
Synonyms: Pimt, Ncoa6ip, D4Ertd800e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 116940
Homologene: 32608
Shisa9
Name: shisa family member 9
Synonyms: CKAMP44, 2700045P11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72555
Homologene: 109462
Itih4
Name: inter alpha-trypsin inhibitor, heavy chain 4
Synonyms: Itih-4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16427
HGNC: HGNC:6169
Homologene: 1670
Fhod3
Name: formin homology 2 domain containing 3
Synonyms: A930009H06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225288
VEGA: 18
Homologene: 45323
Fbln5
Name: fibulin 5
Synonyms: EVEC
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 23876
VEGA: 12
HGNC: HGNC:3602
Homologene: 38170
Uap1
Name: UDP-N-acetylglucosamine pyrophosphorylase 1
Synonyms: AGX1, AgX, ESTM38, SPAG2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107652
Homologene: 2342
Or2g7
Name: olfactory receptor family 2 subfamily G member 7
Synonyms: GA_x6K02T2PSCP-2515350-2516303, Olfr130, MOR256-19
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258480
Homologene: 105876
Ndufs3
Name: NADH:ubiquinone oxidoreductase core subunit S3
Synonyms: 0610010M09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68349
HGNC: HGNC:7710
Homologene: 3346
Dlgap1
Name: DLG associated protein 1
Synonyms: Sapap1, 4933422O14Rik, DAP-1 beta, SAPAP1, D17Bwg0511e, Gkap, GKAP/SAPAP
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224997
HGNC: HGNC:2905
Homologene: 31258
Igsf21
Name: immunoglobulin superfamily, member 21
Synonyms: LOC230868
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230868
Homologene: 13153
Sgpp1
Name: sphingosine-1-phosphate phosphatase 1
Synonyms: SPP1, mSPP1, SPP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 81535
VEGA: 12
Homologene: 101696
Or52e19
Name: olfactory receptor family 52 subfamily E member 19
Synonyms: Olfr596-ps1, GA_x6K02T2PBJ9-6019769-6019943, Olfr596, Gm15117, ENSMUSG00000073953
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100041187
Homologene: 121535
Gm340
Name: predicted gene 340
Synonyms: LOC381224
Type: Gene
Species: Mouse
Chromosome: 19
Hand1
Name: heart and neural crest derivatives expressed 1
Synonyms: Hxt, bHLHa27, Thing1, eHAND, Ehand1, Th1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15110
HGNC: HGNC:4807
Homologene: 3545
Rnaseh1
Name: ribonuclease H1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19819
VEGA: 12
Homologene: 2202
Ikzf2
Name: IKAROS family zinc finger 2
Synonyms: Zfpn1a2, A730095J18Rik, Helios
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22779
Homologene: 22659
Rpp14
Name: ribonuclease P 14 subunit
Synonyms: 2610511E03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67053
Homologene: 5113
Or8g50
Name: olfactory receptor family 8 subfamily G member 50
Synonyms: GA_x6K02T2PVTD-33434302-33435240, M93, MOR171-18, Olfr150
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258602
VEGA: 9
Krtap4-1
Name: keratin associated protein 4-1
Synonyms: A030010K20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 665891
Prkra
Name: protein kinase, interferon inducible double stranded RNA dependent activator
Synonyms: PRK, RAX, lear, Pact
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 23992
HGNC: HGNC:9438
Homologene: 2738
Or4c101
Name: olfactory receptor family 4 subfamily C member 101
Synonyms: GA_x6K02T2Q125-50046879-50047784, Olfr1188, MOR238-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258921
Tmem215
Name: transmembrane protein 215
Synonyms: A930001M12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320500
Homologene: 27946
Lrrc73
Name: leucine rich repeat containing 73
Synonyms: Gm88, LOC224813
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224813
VEGA: 17
Homologene: 19183
Gtpbp8
Name: GTP-binding protein 8 (putative)
Synonyms: 0610037H22Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66067
Homologene: 32209
Zbed3
Name: zinc finger, BED type containing 3
Synonyms: 0610037K01Rik, 2610005H11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72114
VEGA: 13
Homologene: 12442
Tnfsf10
Name: tumor necrosis factor (ligand) superfamily, member 10
Synonyms: A330042I21Rik, APO-2L, Trail
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22035
Homologene: 2824
Pcdhac2
Name: protocadherin alpha subfamily C, 2
Synonyms: CNRc2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 353237
HGNC: HGNC:8677
Homologene: 49562
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 20,502,952 bp
  • G to A, chromosome 1 at 69,539,478 bp
  • T to C, chromosome 1 at 87,765,445 bp
  • T to A, chromosome 1 at 118,503,853 bp
  • TGGGG to TGGGGG, chromosome 1 at 131,981,449 bp
  • A to C, chromosome 1 at 162,675,726 bp
  • A to T, chromosome 1 at 170,149,444 bp
  • G to A, chromosome 1 at 179,610,022 bp
  • C to A, chromosome 2 at 26,061,593 bp
  • C to A, chromosome 2 at 30,284,530 bp
  • T to C, chromosome 2 at 75,937,252 bp
  • T to C, chromosome 2 at 76,630,512 bp
  • T to C, chromosome 2 at 76,762,717 bp
  • C to A, chromosome 2 at 84,686,188 bp
  • T to A, chromosome 2 at 86,553,677 bp
  • T to A, chromosome 2 at 88,559,519 bp
  • C to T, chromosome 2 at 90,894,873 bp
  • G to T, chromosome 3 at 25,434,431 bp
  • G to A, chromosome 3 at 27,335,230 bp
  • C to T, chromosome 3 at 51,388,843 bp
  • T to C, chromosome 3 at 64,116,751 bp
  • C to A, chromosome 3 at 96,173,065 bp
  • A to G, chromosome 3 at 123,485,500 bp
  • A to G, chromosome 3 at 135,270,811 bp
  • C to A, chromosome 4 at 3,593,491 bp
  • T to A, chromosome 4 at 40,473,945 bp
  • A to T, chromosome 4 at 45,906,922 bp
  • T to C, chromosome 4 at 56,922,384 bp
  • T to A, chromosome 4 at 103,048,302 bp
  • C to T, chromosome 4 at 108,055,520 bp
  • A to G, chromosome 4 at 140,157,471 bp
  • A to C, chromosome 4 at 151,144,702 bp
  • T to C, chromosome 4 at 153,979,005 bp
  • A to T, chromosome 5 at 9,570,464 bp
  • A to T, chromosome 5 at 14,713,178 bp
  • G to T, chromosome 5 at 25,319,012 bp
  • G to A, chromosome 5 at 38,750,408 bp
  • T to A, chromosome 5 at 84,108,027 bp
  • T to C, chromosome 5 at 87,980,450 bp
  • A to G, chromosome 5 at 114,105,816 bp
  • A to T, chromosome 6 at 43,307,588 bp
  • T to C, chromosome 6 at 115,617,720 bp
  • A to T, chromosome 7 at 29,090,997 bp
  • T to C, chromosome 7 at 103,309,979 bp
  • T to A, chromosome 7 at 104,153,892 bp
  • T to C, chromosome 7 at 133,643,702 bp
  • C to T, chromosome 8 at 36,511,800 bp
  • A to T, chromosome 8 at 69,820,648 bp
  • C to A, chromosome 8 at 72,723,464 bp
  • C to T, chromosome 8 at 95,126,567 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • G to A, chromosome 9 at 39,737,590 bp
  • A to T, chromosome 9 at 44,075,879 bp
  • A to G, chromosome 9 at 67,047,856 bp
  • A to G, chromosome 9 at 88,364,820 bp
  • T to C, chromosome 10 at 78,207,889 bp
  • A to G, chromosome 10 at 130,425,610 bp
  • A to G, chromosome 11 at 6,514,916 bp
  • G to T, chromosome 11 at 55,303,721 bp
  • A to C, chromosome 11 at 57,831,722 bp
  • G to T, chromosome 11 at 62,867,623 bp
  • A to T, chromosome 11 at 83,186,650 bp
  • G to T, chromosome 11 at 99,627,882 bp
  • A to G, chromosome 11 at 107,073,016 bp
  • A to G, chromosome 11 at 110,130,635 bp
  • A to G, chromosome 12 at 28,658,291 bp
  • T to C, chromosome 12 at 75,735,464 bp
  • A to T, chromosome 12 at 101,750,782 bp
  • A to G, chromosome 13 at 55,245,854 bp
  • T to A, chromosome 13 at 95,336,491 bp
  • T to A, chromosome 14 at 8,083,772 bp
  • G to T, chromosome 14 at 20,460,392 bp
  • C to G, chromosome 14 at 30,896,693 bp
  • G to A, chromosome 14 at 37,088,967 bp
  • A to T, chromosome 14 at 50,360,977 bp
  • G to A, chromosome 14 at 103,843,229 bp
  • T to A, chromosome 15 at 30,332,016 bp
  • T to C, chromosome 15 at 75,948,313 bp
  • T to A, chromosome 15 at 81,676,543 bp
  • C to T, chromosome 15 at 103,896,013 bp
  • T to A, chromosome 16 at 11,985,038 bp
  • C to A, chromosome 16 at 36,782,357 bp
  • G to A, chromosome 16 at 44,746,148 bp
  • C to A, chromosome 17 at 12,390,220 bp
  • T to C, chromosome 17 at 15,368,697 bp
  • T to C, chromosome 17 at 38,067,288 bp
  • T to C, chromosome 17 at 46,254,367 bp
  • T to A, chromosome 17 at 56,064,110 bp
  • T to A, chromosome 17 at 70,516,860 bp
  • T to C, chromosome 17 at 73,910,227 bp
  • T to A, chromosome 17 at 74,419,591 bp
  • C to A, chromosome 18 at 25,028,083 bp
  • T to C, chromosome 18 at 37,144,705 bp
  • A to T, chromosome 19 at 41,584,960 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9035 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068864-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.