Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9035Btlr/Mmmh
Stock Number:
068864-MU
Citation ID:
RRID:MMRRC_068864-MU
Other Names:
R9035 (G1)
Major Collection:

Strain Information

Ednrb
Name: endothelin receptor type B
Synonyms: ETb, Sox10m1, ETR-b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13618
VEGA: 14
HGNC: HGNC:3180
Homologene: 89
Kmt2c
Name: lysine (K)-specific methyltransferase 2C
Synonyms: E330008K23Rik, HALR, Mll3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231051
Homologene: 46480
Trmt9b
Name: tRNA methyltransferase 9B
Synonyms: 6430573F11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319582
Homologene: 35306
Plg
Name: plasminogen
Synonyms: Pg
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18815
VEGA: 17
HGNC: HGNC:9071
Homologene: 55452
Prss12
Name: serine protease 12 neurotrypsin (motopsin)
Synonyms: Bssp-3, motopsin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 19142
HGNC: HGNC:9477
Homologene: 7490
Nsd1
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 20,502,952 bp
  • G to A, chromosome 1 at 69,539,478 bp
  • T to C, chromosome 1 at 87,765,445 bp
  • T to A, chromosome 1 at 118,503,853 bp
  • TGGGG to TGGGGG, chromosome 1 at 131,981,449 bp
  • A to C, chromosome 1 at 162,675,726 bp
  • A to T, chromosome 1 at 170,149,444 bp
  • G to A, chromosome 1 at 179,610,022 bp
  • C to A, chromosome 2 at 26,061,593 bp
  • C to A, chromosome 2 at 30,284,530 bp
  • T to C, chromosome 2 at 75,937,252 bp
  • T to C, chromosome 2 at 76,630,512 bp
  • T to C, chromosome 2 at 76,762,717 bp
  • C to A, chromosome 2 at 84,686,188 bp
  • T to A, chromosome 2 at 86,553,677 bp
  • T to A, chromosome 2 at 88,559,519 bp
  • C to T, chromosome 2 at 90,894,873 bp
  • G to T, chromosome 3 at 25,434,431 bp
  • G to A, chromosome 3 at 27,335,230 bp
  • C to T, chromosome 3 at 51,388,843 bp
  • T to C, chromosome 3 at 64,116,751 bp
  • C to A, chromosome 3 at 96,173,065 bp
  • A to G, chromosome 3 at 123,485,500 bp
  • A to G, chromosome 3 at 135,270,811 bp
  • C to A, chromosome 4 at 3,593,491 bp
  • T to A, chromosome 4 at 40,473,945 bp
  • A to T, chromosome 4 at 45,906,922 bp
  • T to C, chromosome 4 at 56,922,384 bp
  • T to A, chromosome 4 at 103,048,302 bp
  • C to T, chromosome 4 at 108,055,520 bp
  • A to G, chromosome 4 at 140,157,471 bp
  • A to C, chromosome 4 at 151,144,702 bp
  • T to C, chromosome 4 at 153,979,005 bp
  • A to T, chromosome 5 at 9,570,464 bp
  • A to T, chromosome 5 at 14,713,178 bp
  • G to T, chromosome 5 at 25,319,012 bp
  • G to A, chromosome 5 at 38,750,408 bp
  • T to A, chromosome 5 at 84,108,027 bp
  • T to C, chromosome 5 at 87,980,450 bp
  • A to G, chromosome 5 at 114,105,816 bp
  • A to T, chromosome 6 at 43,307,588 bp
  • T to C, chromosome 6 at 115,617,720 bp
  • A to T, chromosome 7 at 29,090,997 bp
  • T to C, chromosome 7 at 103,309,979 bp
  • T to A, chromosome 7 at 104,153,892 bp
  • T to C, chromosome 7 at 133,643,702 bp
  • C to T, chromosome 8 at 36,511,800 bp
  • A to T, chromosome 8 at 69,820,648 bp
  • C to A, chromosome 8 at 72,723,464 bp
  • C to T, chromosome 8 at 95,126,567 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • G to A, chromosome 9 at 39,737,590 bp
  • A to T, chromosome 9 at 44,075,879 bp
  • A to G, chromosome 9 at 67,047,856 bp
  • A to G, chromosome 9 at 88,364,820 bp
  • T to C, chromosome 10 at 78,207,889 bp
  • A to G, chromosome 10 at 130,425,610 bp
  • A to G, chromosome 11 at 6,514,916 bp
  • G to T, chromosome 11 at 55,303,721 bp
  • A to C, chromosome 11 at 57,831,722 bp
  • G to T, chromosome 11 at 62,867,623 bp
  • A to T, chromosome 11 at 83,186,650 bp
  • G to T, chromosome 11 at 99,627,882 bp
  • A to G, chromosome 11 at 107,073,016 bp
  • A to G, chromosome 11 at 110,130,635 bp
  • A to G, chromosome 12 at 28,658,291 bp
  • T to C, chromosome 12 at 75,735,464 bp
  • A to T, chromosome 12 at 101,750,782 bp
  • A to G, chromosome 13 at 55,245,854 bp
  • T to A, chromosome 13 at 95,336,491 bp
  • T to A, chromosome 14 at 8,083,772 bp
  • G to T, chromosome 14 at 20,460,392 bp
  • C to G, chromosome 14 at 30,896,693 bp
  • G to A, chromosome 14 at 37,088,967 bp
  • A to T, chromosome 14 at 50,360,977 bp
  • G to A, chromosome 14 at 103,843,229 bp
  • T to A, chromosome 15 at 30,332,016 bp
  • T to C, chromosome 15 at 75,948,313 bp
  • T to A, chromosome 15 at 81,676,543 bp
  • C to T, chromosome 15 at 103,896,013 bp
  • T to A, chromosome 16 at 11,985,038 bp
  • C to A, chromosome 16 at 36,782,357 bp
  • G to A, chromosome 16 at 44,746,148 bp
  • C to A, chromosome 17 at 12,390,220 bp
  • T to C, chromosome 17 at 15,368,697 bp
  • T to C, chromosome 17 at 38,067,288 bp
  • T to C, chromosome 17 at 46,254,367 bp
  • T to A, chromosome 17 at 56,064,110 bp
  • T to A, chromosome 17 at 70,516,860 bp
  • T to C, chromosome 17 at 73,910,227 bp
  • T to A, chromosome 17 at 74,419,591 bp
  • C to A, chromosome 18 at 25,028,083 bp
  • T to C, chromosome 18 at 37,144,705 bp
  • A to T, chromosome 19 at 41,584,960 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9035 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068864-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.