Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9050Btlr/Mmmh
Stock Number:
068876-MU
Citation ID:
RRID:MMRRC_068876-MU
Other Names:
R9050 (G1)
Major Collection:

Strain Information

Hps5
Name: HPS5, biogenesis of lysosomal organelles complex 2 subunit 2
Synonyms: ru-2, ruby eye 2, ru2, Hermansky-Pudlak syndrome 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246694
Homologene: 35333
Suz12
Name: SUZ12 polycomb repressive complex 2 subunit
Synonyms: 2610028O16Rik, D11Ertd530e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52615
Homologene: 32256
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Mrpl39
Name: mitochondrial ribosomal protein L39
Synonyms: MRP-L5, Rpml5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27393
Homologene: 9679
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: med, seal, motor end-plate disease, nmf2, ataxia 3, mnd2, mnd-2, C630029C19Rik, nmf58, NaCh6, Nav1.6, nmf335, NMF335, nur14
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20273
Homologene: 7927
Sec24d
Name: SEC24 homolog D, COPII coat complex component
Synonyms: 2310020L09Rik, LOC383951
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69608
Homologene: 40986
Thada
Name: thyroid adenoma associated
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240174
VEGA: 17
Homologene: 75175
Atp5f1c
Name: ATP synthase F1 subunit gamma
Synonyms: F1 gamma, 1700094F02Rik, Atp5c1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11949
HGNC: HGNC:833
Homologene: 3792
Atxn3
Name: ataxin 3
Synonyms: Sca3, MJD1, 2210008M02Rik, ataxin-3, Mjd, Atx3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110616
HGNC: HGNC:7106
Homologene: 3658
Cep350
Name: centrosomal protein 350
Synonyms: 6430546F08Rik, 4933409L06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74081
Homologene: 8879
Abhd5
Name: abhydrolase domain containing 5
Synonyms: NCIE2, IECN5, 1300003D03Rik, 2010002J10Rik, CGI-58
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67469
Homologene: 41088
Oga
Name: O-GlcNAcase
Synonyms: Hy5, 5830447M11Rik, 4833427O07Rik, 2810009A20Rik, Mgea5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76055
VEGA: 19
HGNC: HGNC:7056
Homologene: 8154
Il7
Name: interleukin 7
Synonyms: Il-7, hlb368, A630026I06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16196
HGNC: HGNC:6023
Homologene: 680
Pfas
Name: phosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms: 4432409B16Rik, Sofa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237823
HGNC: HGNC:8863
Homologene: 5970
Spag9
Name: sperm associated antigen 9
Synonyms: 4733401I23Rik, syd1, 4831406C20Rik, Mapk8ip4, JIP4, 3110018C07Rik, JLP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70834
Homologene: 2954
Calcoco1
Name: calcium binding and coiled coil domain 1
Synonyms: 1810009B06Rik, CoCoA, Gcap11
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67488
Homologene: 10845
Mtr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase
Synonyms: methionine synthase, MS, D830038K18Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238505
VEGA: 13
HGNC: HGNC:7468
Homologene: 37280
Spats2
Name: spermatogenesis associated, serine-rich 2
Synonyms: 2700012F11Rik, p59scr, 59kDa, Scr59
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72572
VEGA: 15
Homologene: 11314
Clec9a
Name: C-type lectin domain family 9, member a
Synonyms: 9830005G06Rik, DNGR-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232414
Homologene: 52106
Col5a3
Name: collagen, type V, alpha 3
Synonyms: Pro-alpha3(V)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53867
Homologene: 9253
Zfp791
Name: zinc finger protein 791
Synonyms: EG244556
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244556
Homologene: 27420
Kmt5c
Name: lysine methyltransferase 5C
Synonyms: Suv4-20h2, Suv420h2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232811
Homologene: 32792
Or5p62
Name: olfactory receptor family 5 subfamily P member 62
Synonyms: GA_x6K02T2PBJ9-10501920-10500976, MOR204-19, Olfr486
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258489
Homologene: 110483
Cdhr2
Name: cadherin-related family member 2
Synonyms: LOC268663, Pcdh24
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 268663
Homologene: 134510
Ngef
Name: neuronal guanine nucleotide exchange factor
Synonyms: ephexin, Tims2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 53972
HGNC: HGNC:7807
Homologene: 75120
Nmrk1
Name: nicotinamide riboside kinase 1
Synonyms: D630020N23Rik, BC016495
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225994
Homologene: 6787
Glp1r
Name: glucagon-like peptide 1 receptor
Synonyms: GLP-1R, GLP1Rc
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14652
VEGA: 17
HGNC: HGNC:4324
Homologene: 1558
Slc6a15
Name: solute carrier family 6 (neurotransmitter transporter), member 15
Synonyms: v7-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103098
VEGA: 10
Homologene: 18163
Gabbr2
Name: gamma-aminobutyric acid type B receptor subunit 2
Synonyms: Gababr2, LOC242425, Gpr51, GB2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242425
HGNC: HGNC:4507
Homologene: 55902
Togaram2
Name: TOG array regulator of axonemal microtubules 2
Synonyms: 4632412N22Rik, Fam179a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320159
Homologene: 65315
Ttbk2
Name: tau tubulin kinase 2
Synonyms: TTK, B930008N24Rik, 2610507N02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140810
Homologene: 62795
Rabggta
Name: Rab geranylgeranyl transferase, a subunit
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56187
VEGA: 14
HGNC: HGNC:9795
Homologene: 32443
Pcdhb17
Name: protocadherin beta 17
Synonyms: Pcdhb16, PcdhbQ
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93888
Homologene: 81881
Zer1
Name: zyg-11 related, cell cycle regulator
Synonyms: C230075L19Rik, Zyg11bl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227693
Homologene: 4621
Slc47a1
Name: solute carrier family 47, member 1
Synonyms: 1300013J15Rik, MATE1, mMATE1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67473
Homologene: 34364
Ssx2ip
Name: SSX family member 2 interacting protein
Synonyms: Adip
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99167
Homologene: 8522
Or2y1e
Name: olfactory receptor family 2 subfamily Y member 1E
Synonyms: GA_x6K02T2QP88-6107233-6106298, MOR256-27, Olfr1391
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258460
Homologene: 17264
Tubgcp4
Name: tubulin, gamma complex component 4
Synonyms: 4932441P04Rik, D2Ertd435e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51885
Homologene: 8690
Or1o4
Name: olfactory receptor family 1 subfamily O member 4
Synonyms: MOR156-1, GA_x6K02T2PSCP-1720261-1719344, Olfr99
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258508
Homologene: 74030
Fmo4
Name: flavin containing monooxygenase 4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226564
HGNC: HGNC:3772
Homologene: 68219
Ston1
Name: stonin 1
Synonyms: 4921524J06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 77057
Homologene: 122152
Nicol1
Name: NELL2 interacting cell ontogeny regulator 1
Synonyms: LOC381633, Gm1673
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381633
Homologene: 134513
Slfn9
Name: schlafen 9
Synonyms: 9830137M10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237886
Homologene: 45432
Tbc1d24
Name: TBC1 domain family, member 24
Synonyms: C530046L02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224617
Homologene: 27469
Herpud1
Name: homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1
Synonyms: Herp, Mifl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 64209
Homologene: 40973
Cby3
Name: chibby family member 3
Synonyms: 1700121K02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76653
Homologene: 67734
Or2b2
Name: olfactory receptor family 2 subfamily B member 2
Synonyms: GA_x6K02T2QHY8-11534186-11533245, MOR256-60, MOR256-35, Olfr1359
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 258067
Homologene: 11056
Pth
Name: parathyroid hormone
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19226
HGNC: HGNC:9606
Homologene: 266
Obox8
Name: oocyte specific homeobox 8
Synonyms: Gm5585
Type: Gene
Species: Mouse
Chromosome: 7
Sprr2b
Name: small proline-rich protein 2B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20756
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 87,503,288 bp
  • A to T, chromosome 1 at 155,862,941 bp
  • A to G, chromosome 1 at 162,807,530 bp
  • A to T, chromosome 2 at 10,064,238 bp
  • A to T, chromosome 2 at 30,111,282 bp
  • C to T, chromosome 2 at 52,189,889 bp
  • A to T, chromosome 2 at 120,806,838 bp
  • G to A, chromosome 2 at 121,173,598 bp
  • A to G, chromosome 3 at 7,604,110 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • T to C, chromosome 3 at 123,350,725 bp
  • C to T, chromosome 3 at 146,438,757 bp
  • C to A, chromosome 4 at 43,549,786 bp
  • A to G, chromosome 4 at 46,798,659 bp
  • A to T, chromosome 4 at 143,726,759 bp
  • G to C, chromosome 5 at 33,983,530 bp
  • G to C, chromosome 6 at 129,419,598 bp
  • A to G, chromosome 7 at 4,742,282 bp
  • A to G, chromosome 7 at 14,332,945 bp
  • T to C, chromosome 7 at 46,773,183 bp
  • A to C, chromosome 7 at 108,171,880 bp
  • A to G, chromosome 7 at 113,385,836 bp
  • T to C, chromosome 8 at 33,342,993 bp
  • T to C, chromosome 8 at 85,110,705 bp
  • T to C, chromosome 8 at 94,390,826 bp
  • C to T, chromosome 9 at 20,786,395 bp
  • A to G, chromosome 9 at 46,233,294 bp
  • T to C, chromosome 9 at 122,379,540 bp
  • A to T, chromosome 10 at 103,416,655 bp
  • T to C, chromosome 11 at 49,328,103 bp
  • A to G, chromosome 11 at 50,357,790 bp
  • T to C, chromosome 11 at 61,344,334 bp
  • A to G, chromosome 11 at 68,991,741 bp
  • C to T, chromosome 11 at 80,022,197 bp
  • G to A, chromosome 11 at 82,988,294 bp
  • A to G, chromosome 11 at 94,044,468 bp
  • A to T, chromosome 12 at 101,958,128 bp
  • A to G, chromosome 12 at 102,369,479 bp
  • T to C, chromosome 13 at 12,216,862 bp
  • A to G, chromosome 13 at 21,702,980 bp
  • A to G, chromosome 13 at 54,735,320 bp
  • T to A, chromosome 14 at 55,721,599 bp
  • G to T, chromosome 15 at 99,212,129 bp
  • G to A, chromosome 15 at 101,008,280 bp
  • A to G, chromosome 15 at 102,709,965 bp
  • A to C, chromosome 16 at 84,734,956 bp
  • A to T, chromosome 17 at 24,185,924 bp
  • C to A, chromosome 17 at 24,185,925 bp
  • G to A, chromosome 17 at 30,918,918 bp
  • A to G, chromosome 17 at 37,279,929 bp
  • T to C, chromosome 17 at 71,700,883 bp
  • A to G, chromosome 17 at 84,429,201 bp
  • A to G, chromosome 17 at 88,636,800 bp
  • T to G, chromosome 18 at 37,487,233 bp
  • T to A, chromosome 19 at 18,641,175 bp
  • T to C, chromosome 19 at 45,767,915 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9050 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068876-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.