Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9050Btlr/Mmmh
Stock Number:
068876-MU
Citation ID:
RRID:MMRRC_068876-MU
Other Names:
R9050 (G1)
Major Collection:

Strain Information

Hps5
Name: HPS5, biogenesis of lysosomal organelles complex 2 subunit 2
Synonyms: ru-2, ruby eye 2, ru2, Hermansky-Pudlak syndrome 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246694
Homologene: 35333
Suz12
Name: SUZ12 polycomb repressive complex 2 subunit
Synonyms: 2610028O16Rik, D11Ertd530e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52615
Homologene: 32256
Wrn
Name: Werner syndrome RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22427
Homologene: 6659
Mrpl39
Name: mitochondrial ribosomal protein L39
Synonyms: MRP-L5, Rpml5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27393
Homologene: 9679
Scn8a
Name: sodium channel, voltage-gated, type VIII, alpha
Synonyms: med, seal, motor end-plate disease, nmf2, ataxia 3, mnd2, mnd-2, C630029C19Rik, nmf58, NaCh6, Nav1.6, nmf335, NMF335, nur14
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20273
Homologene: 7927
Sec24d
Name: SEC24 homolog D, COPII coat complex component
Synonyms: 2310020L09Rik, LOC383951
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69608
Homologene: 40986
Thada
Name: thyroid adenoma associated
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240174
VEGA: 17
Homologene: 75175
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 87,503,288 bp
  • A to T, chromosome 1 at 155,862,941 bp
  • A to G, chromosome 1 at 162,807,530 bp
  • A to T, chromosome 2 at 10,064,238 bp
  • A to T, chromosome 2 at 30,111,282 bp
  • C to T, chromosome 2 at 52,189,889 bp
  • A to T, chromosome 2 at 120,806,838 bp
  • G to A, chromosome 2 at 121,173,598 bp
  • A to G, chromosome 3 at 7,604,110 bp
  • CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC to CTGAGCCTTGTCCTCCTCCAAAGTGCCCTGAGCCTTGTCCTCCCCCAGTATGCTGTGAGCCTTGTCCTCC, chromosome 3 at 92,317,519 bp
  • T to C, chromosome 3 at 123,350,725 bp
  • C to T, chromosome 3 at 146,438,757 bp
  • C to A, chromosome 4 at 43,549,786 bp
  • A to G, chromosome 4 at 46,798,659 bp
  • A to T, chromosome 4 at 143,726,759 bp
  • G to C, chromosome 5 at 33,983,530 bp
  • G to C, chromosome 6 at 129,419,598 bp
  • A to G, chromosome 7 at 4,742,282 bp
  • A to G, chromosome 7 at 14,332,945 bp
  • T to C, chromosome 7 at 46,773,183 bp
  • A to C, chromosome 7 at 108,171,880 bp
  • A to G, chromosome 7 at 113,385,836 bp
  • T to C, chromosome 8 at 33,342,993 bp
  • T to C, chromosome 8 at 85,110,705 bp
  • T to C, chromosome 8 at 94,390,826 bp
  • C to T, chromosome 9 at 20,786,395 bp
  • A to G, chromosome 9 at 46,233,294 bp
  • T to C, chromosome 9 at 122,379,540 bp
  • A to T, chromosome 10 at 103,416,655 bp
  • T to C, chromosome 11 at 49,328,103 bp
  • A to G, chromosome 11 at 50,357,790 bp
  • T to C, chromosome 11 at 61,344,334 bp
  • A to G, chromosome 11 at 68,991,741 bp
  • C to T, chromosome 11 at 80,022,197 bp
  • G to A, chromosome 11 at 82,988,294 bp
  • A to G, chromosome 11 at 94,044,468 bp
  • A to T, chromosome 12 at 101,958,128 bp
  • A to G, chromosome 12 at 102,369,479 bp
  • T to C, chromosome 13 at 12,216,862 bp
  • A to G, chromosome 13 at 21,702,980 bp
  • A to G, chromosome 13 at 54,735,320 bp
  • T to A, chromosome 14 at 55,721,599 bp
  • G to T, chromosome 15 at 99,212,129 bp
  • G to A, chromosome 15 at 101,008,280 bp
  • A to G, chromosome 15 at 102,709,965 bp
  • A to C, chromosome 16 at 84,734,956 bp
  • A to T, chromosome 17 at 24,185,924 bp
  • C to A, chromosome 17 at 24,185,925 bp
  • G to A, chromosome 17 at 30,918,918 bp
  • A to G, chromosome 17 at 37,279,929 bp
  • T to C, chromosome 17 at 71,700,883 bp
  • A to G, chromosome 17 at 84,429,201 bp
  • A to G, chromosome 17 at 88,636,800 bp
  • T to G, chromosome 18 at 37,487,233 bp
  • T to A, chromosome 19 at 18,641,175 bp
  • T to C, chromosome 19 at 45,767,915 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9050 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068876-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.