Strain Name:
C57BL/6J-MtgxR9071Btlr/Mmmh
Stock Number:
068893-MU
Citation ID:
RRID:MMRRC_068893-MU
Other Names:
R9071 (G1)
Major Collection:

Strain Information

Matr3
Name: matrin 3
Synonyms: 2810017I02Rik, D030046F20Rik, 1110061A14Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17184
HGNC: HGNC:6912
Homologene: 7830
Sema3e
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E
Synonyms: Semah
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20349
Homologene: 8247
Crhr1
Name: corticotropin releasing hormone receptor 1
Synonyms: CRFR1, CRF 1 receptor, CRF1R, CRF-R1alpha
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12921
Homologene: 20920
Slco1a5
Name: solute carrier organic anion transporter family, member 1a5
Synonyms: Oatp3, Slc21a7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108096
Homologene: 56603
Clybl
Name: citrate lyase beta like
Synonyms: Clb, 2310014M14Rik, 0610033J05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69634
VEGA: 14
Homologene: 49925
Zc3h7b
Name: zinc finger CCCH type containing 7B
Synonyms: Scrg3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20286
VEGA: 15
Homologene: 9735
2610021A01Rik
Name: RIKEN cDNA 2610021A01 gene
Type: Gene
Species: Mouse
Chromosome: 7
Nampt
Name: nicotinamide phosphoribosyltransferase
Synonyms: Pbef1, Visfatin, 1110035O14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 59027
VEGA: 12
Homologene: 4201
Scaper
Name: S phase cyclin A-associated protein in the ER
Synonyms: D530014O03Rik, Zfp291
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244891
VEGA: 9
Homologene: 32488
Mki67
Name: antigen identified by monoclonal antibody Ki 67
Synonyms: Ki-67, D630048A14Rik, Ki67
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17345
HGNC: HGNC:7107
Homologene: 1814
Eif3a
Name: eukaryotic translation initiation factor 3, subunit A
Synonyms: Csma, Eif3, Eif3s10, A830012B05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13669
VEGA: 19
HGNC: HGNC:3271
Homologene: 2779
Fasn
Name: fatty acid synthase
Synonyms: FAS, A630082H08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14104
HGNC: HGNC:3594
Homologene: 55800
Atg2b
Name: autophagy related 2B
Synonyms: 2410024A21Rik, C030004M05Rik, C630028L02Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76559
VEGA: 12
Homologene: 9974
Atg16l1
Name: autophagy related 16 like 1
Synonyms: 1500009K01Rik, APG16L, WDR30
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77040
Homologene: 41786
Myt1
Name: myelin transcription factor 1
Synonyms: Nztf2, NZF-2a, NZF-2b, Nzf2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17932
HGNC: HGNC:7622
Homologene: 3332
Card6
Name: caspase recruitment domain family, member 6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239319
Homologene: 13067
Cspp1
Name: centrosome and spindle pole associated protein 1
Synonyms: 4930413O22Rik, 2310020J12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 211660
Homologene: 23487
Cog1
Name: component of oligomeric golgi complex 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16834
HGNC: HGNC:6545
Homologene: 8411
Plod2
Name: procollagen lysine, 2-oxoglutarate 5-dioxygenase 2
Synonyms: LH2, D530025C14Rik, Plod-2, lysyl hydroxylase 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 26432
HGNC: HGNC:9082
Homologene: 22681
Prdm4
Name: PR domain containing 4
Synonyms: SC-1, SC1, 1700031E19Rik, 2810470D21Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72843
VEGA: 10
HGNC: HGNC:9348
Homologene: 8235
Ddx41
Name: DEAD box helicase 41
Synonyms: 2900024F02Rik, DEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72935
VEGA: 13
Homologene: 9431
Osbpl10
Name: oxysterol binding protein-like 10
Synonyms: OPR-10, C820004B04Rik, 4933433D06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74486
Homologene: 69240
Cenpk
Name: centromere protein K
Synonyms: C530004N04Rik, B130045K24Rik, Solt
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 60411
VEGA: 13
Homologene: 11035
Amotl2
Name: angiomotin-like 2
Synonyms: MASCOT, Lccp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56332
Homologene: 9420
Ddx11
Name: DEAD/H box helicase 11
Synonyms: 4732462I11Rik, CHL1, KRG2, CHLR1, DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11, essa15a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320209
VEGA: 17
Homologene: 68973
Sez6l
Name: seizure related 6 homolog like
Synonyms: Acig1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56747
Homologene: 10895
Hgsnat
Name: heparan-alpha-glucosaminide N-acetyltransferase
Synonyms: D8Ertd354e, 9430010M12Rik, Tmem76
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52120
Homologene: 15586
Cul9
Name: cullin 9
Synonyms: 1810035I07Rik, Parc
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78309
Homologene: 56696
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Msto1
Name: misato 1, mitochondrial distribution and morphology regulator
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229524
Homologene: 41228
Ifi207
Name: interferon activated gene 207
Synonyms: Pyhin-A, AI607873
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226691
HGNC: HGNC:5395
Homologene: 115929
Alpi
Name: alkaline phosphatase, intestinal
Synonyms: 2010001C14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76768
Homologene: 122414
Sult1e1
Name: sulfotransferase family 1E, member 1
Synonyms: Ste, EST
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20860
Homologene: 101388
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230806
Homologene: 19232
Tas2r125
Name: taste receptor, type 2, member 125
Synonyms: mGR25, mt2r59, Tas2r25, T2R26
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387352
Homologene: 87294
Cyp2d10
Name: cytochrome P450, family 2, subfamily d, polypeptide 10
Synonyms: Cyp2d, P450-2D
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13101
VEGA: 15
Homologene: 86099
Nell2
Name: NEL-like 2
Synonyms: A330108N19Rik, mel91
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54003
VEGA: 15
HGNC: HGNC:7751
Homologene: 4488
Fam83f
Name: family with sequence similarity 83, member F
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 213956
VEGA: 15
Homologene: 16313
Nfe2l3
Name: nuclear factor, erythroid derived 2, like 3
Synonyms: Nrf3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18025
HGNC: HGNC:7783
Homologene: 3168
Ano3
Name: anoctamin 3
Synonyms: Tmem16c, B230324K02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228432
Homologene: 57147
Ccdc162
Name: coiled-coil domain containing 162
Synonyms: Gm29096, 5033413D22Rik, Gm6976
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75973
Homologene: 136355
Zfp28
Name: zinc finger protein 28
Synonyms: 2810438M17Rik, Zfp-28, mkr-5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22690
Homologene: 69047
Wdr20rt
Name: WD repeat domain 20, retrogene
Synonyms: 4930427E19Rik, 4921538B03Rik, Wdr20b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70948
VEGA: 12
Moap1
Name: modulator of apoptosis 1
Synonyms: MAP-1, 2510001G02Rik, 1700051B17Rik, 9130023M10Rik, 1700127I11Rik, PNMA4, 4930435G24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 64113
Homologene: 11154
Prr27
Name: proline rich 27
Synonyms: 4930432K09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 73779
Homologene: 136277
Ugt3a1
Name: UDP glycosyltransferases 3 family, polypeptide A1
Synonyms: Ugt3a2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223337
Homologene: 122787
Spata4
Name: spermatogenesis associated 4
Synonyms: 1700001N01Rik, TSARG2, SRG2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69281
Homologene: 15868
Igfals
Name: insulin-like growth factor binding protein, acid labile subunit
Synonyms: ALS, Albs
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16005
VEGA: 17
HGNC: HGNC:5468
Homologene: 37987
Or8b43
Name: olfactory receptor family 8 subfamily B member 43
Synonyms: GA_x6K02T2PVTD-32141623-32142552, MOR169-1, Olfr902
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258798
VEGA: 9
Cd3d
Name: CD3 antigen, delta polypeptide
Synonyms: T3d
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12500
VEGA: 9
HGNC: HGNC:1673
Homologene: 585
B3galt9
Name: beta-1,3-galactosyltransferase 9
Synonyms: Gm34653
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102637973
Homologene: 131655
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 10,088,896 bp
  • A to G, chromosome 1 at 87,098,862 bp
  • G to T, chromosome 1 at 87,756,185 bp
  • A to T, chromosome 1 at 173,730,198 bp
  • T to C, chromosome 2 at 32,288,352 bp
  • T to C, chromosome 2 at 34,838,423 bp
  • T to A, chromosome 2 at 110,795,073 bp
  • A to T, chromosome 2 at 181,806,627 bp
  • T to C, chromosome 3 at 38,983,449 bp
  • C to A, chromosome 3 at 88,905,107 bp
  • A to G, chromosome 4 at 134,091,231 bp
  • A to G, chromosome 5 at 14,232,140 bp
  • A to C, chromosome 5 at 87,587,822 bp
  • C to A, chromosome 5 at 87,843,135 bp
  • A to T, chromosome 5 at 112,425,737 bp
  • A to G, chromosome 6 at 48,457,048 bp
  • A to C, chromosome 6 at 51,457,263 bp
  • A to T, chromosome 6 at 132,910,437 bp
  • A to T, chromosome 6 at 142,250,326 bp
  • T to A, chromosome 7 at 6,394,545 bp
  • G to T, chromosome 7 at 41,625,359 bp
  • G to C, chromosome 7 at 135,699,476 bp
  • A to G, chromosome 8 at 25,946,274 bp
  • T to G, chromosome 8 at 54,602,707 bp
  • T to C, chromosome 9 at 38,449,736 bp
  • A to T, chromosome 9 at 44,985,042 bp
  • T to C, chromosome 9 at 55,864,519 bp
  • A to G, chromosome 9 at 92,602,995 bp
  • G to T, chromosome 9 at 102,718,693 bp
  • G to T, chromosome 9 at 115,061,840 bp
  • G to A, chromosome 10 at 41,581,178 bp
  • A to G, chromosome 10 at 85,893,212 bp
  • T to A, chromosome 11 at 104,173,307 bp
  • T to C, chromosome 11 at 113,656,113 bp
  • T to C, chromosome 11 at 120,817,498 bp
  • T to A, chromosome 12 at 32,842,782 bp
  • G to A, chromosome 12 at 65,227,448 bp
  • T to A, chromosome 12 at 102,743,105 bp
  • C to A, chromosome 12 at 105,658,840 bp
  • A to G, chromosome 13 at 55,532,406 bp
  • C to T, chromosome 13 at 104,242,362 bp
  • C to A, chromosome 14 at 122,371,285 bp
  • TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG to TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG, chromosome 15 at 5,098,691 bp
  • T to A, chromosome 15 at 9,370,138 bp
  • T to C, chromosome 15 at 80,692,005 bp
  • T to C, chromosome 15 at 81,793,763 bp
  • T to C, chromosome 15 at 82,404,160 bp
  • T to A, chromosome 15 at 95,346,801 bp
  • A to T, chromosome 17 at 24,880,696 bp
  • T to C, chromosome 17 at 46,526,453 bp
  • T to A, chromosome 17 at 66,143,741 bp
  • T to C, chromosome 18 at 35,572,750 bp
  • T to C, chromosome 19 at 60,763,196 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9071 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068893-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.