Loading...

Strain Detail Sheet

Strain Name:
C57BL/6J-MtgxR9072Btlr/Mmmh
Stock Number:
068894-MU
Citation ID:
RRID:MMRRC_068894-MU
Other Names:
R9072 (G1)
Major Collection:
Beutler Mutagenetix

Strain Information

Gene Details

Sesn2
Name: sestrin 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230784
Homologene: 12873

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Nucb2
Name: nucleobindin 2
Synonyms: NEFA, Calnuc, nesfatin-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53322
HGNC: HGNC:8044
Homologene: 3676

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Med1
Name: mediator complex subunit 1
Synonyms: TRAP 220, TRAP220, CRSP210, DRIP205, Pparbp, l11Jus15, PBP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Pum1
Name: pumilio RNA-binding family member 1
Synonyms: Pumm
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 80912
Homologene: 22830

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Plcb4
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868

Additional Resources
IMPC
Google
Entrez
PubMed
IMSR
Gene Ontology
BioGPS
Gene Cloud
IGTC
Mouse Phenome DB
Mouse Mine
KOMP Phenotyping
Monarch
GeneCards
ClinGen
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 23,922,073 bp
  • A to G, chromosome 1 at 36,319,545 bp
  • A to T, chromosome 1 at 38,811,786 bp
  • T to C, chromosome 1 at 63,305,764 bp
  • C to A, chromosome 1 at 66,414,153 bp
  • G to T, chromosome 1 at 150,455,537 bp
  • A to T, chromosome 1 at 150,689,569 bp
  • A to T, chromosome 1 at 172,560,773 bp
  • A to T, chromosome 1 at 181,182,786 bp
  • G to A, chromosome 2 at 5,008,603 bp
  • T to A, chromosome 2 at 13,010,387 bp
  • A to G, chromosome 2 at 32,565,662 bp
  • G to A, chromosome 2 at 40,725,445 bp
  • T to C, chromosome 2 at 71,089,792 bp
  • T to C, chromosome 2 at 73,613,086 bp
  • C to T, chromosome 2 at 76,755,874 bp
  • ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG to ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG, chromosome 2 at 76,915,806 bp
  • T to C, chromosome 2 at 76,944,839 bp
  • T to A, chromosome 2 at 88,093,828 bp
  • A to C, chromosome 2 at 88,560,314 bp
  • A to G, chromosome 2 at 93,813,799 bp
  • T to A, chromosome 2 at 110,745,898 bp
  • A to T, chromosome 2 at 111,420,360 bp
  • G to A, chromosome 2 at 118,717,397 bp
  • A to G, chromosome 2 at 136,007,875 bp
  • A to G, chromosome 2 at 149,407,341 bp
  • G to C, chromosome 2 at 155,729,292 bp
  • C to G, chromosome 2 at 155,992,115 bp
  • T to C, chromosome 3 at 19,978,994 bp
  • T to C, chromosome 3 at 30,699,710 bp
  • T to C, chromosome 3 at 36,640,682 bp
  • G to A, chromosome 3 at 88,091,576 bp
  • A to G, chromosome 3 at 88,109,466 bp
  • A to C, chromosome 3 at 90,388,461 bp
  • T to A, chromosome 3 at 93,074,034 bp
  • T to C, chromosome 3 at 152,846,319 bp
  • T to C, chromosome 4 at 130,752,861 bp
  • C to A, chromosome 4 at 132,496,884 bp
  • T to A, chromosome 4 at 141,466,365 bp
  • T to C, chromosome 4 at 141,476,391 bp
  • TTGTCATCT to TT, chromosome 5 at 72,160,984 bp
  • T to C, chromosome 5 at 106,898,280 bp
  • T to A, chromosome 5 at 107,717,859 bp
  • C to T, chromosome 5 at 114,404,546 bp
  • T to A, chromosome 5 at 145,154,715 bp
  • T to C, chromosome 6 at 34,799,452 bp
  • T to C, chromosome 6 at 41,951,672 bp
  • C to T, chromosome 6 at 51,879,770 bp
  • T to A, chromosome 6 at 86,944,392 bp
  • T to C, chromosome 6 at 88,618,440 bp
  • G to A, chromosome 6 at 89,869,895 bp
  • C to T, chromosome 6 at 115,792,529 bp
  • T to C, chromosome 6 at 116,401,923 bp
  • T to A, chromosome 6 at 118,523,389 bp
  • C to T, chromosome 6 at 120,792,061 bp
  • A to T, chromosome 7 at 4,759,254 bp
  • A to G, chromosome 7 at 10,725,943 bp
  • C to T, chromosome 7 at 11,756,276 bp
  • G to A, chromosome 7 at 29,166,530 bp
  • C to A, chromosome 7 at 43,617,146 bp
  • A to T, chromosome 7 at 99,472,922 bp
  • T to G, chromosome 7 at 100,391,084 bp
  • A to G, chromosome 7 at 104,153,777 bp
  • C to T, chromosome 7 at 104,636,084 bp
  • A to T, chromosome 7 at 106,741,552 bp
  • T to A, chromosome 7 at 116,526,396 bp
  • C to T, chromosome 7 at 118,183,809 bp
  • T to A, chromosome 7 at 122,528,548 bp
  • G to A, chromosome 7 at 126,672,654 bp
  • T to C, chromosome 7 at 141,473,372 bp
  • A to T, chromosome 8 at 45,942,838 bp
  • A to T, chromosome 8 at 72,695,418 bp
  • G to A, chromosome 8 at 75,126,306 bp
  • T to A, chromosome 8 at 85,010,789 bp
  • G to A, chromosome 8 at 110,267,451 bp
  • T to A, chromosome 9 at 20,771,157 bp
  • T to G, chromosome 9 at 27,397,728 bp
  • T to A, chromosome 9 at 46,233,234 bp
  • A to T, chromosome 9 at 70,410,813 bp
  • T to A, chromosome 9 at 76,997,018 bp
  • G to A, chromosome 9 at 108,827,094 bp
  • T to C, chromosome 9 at 121,460,488 bp
  • A to T, chromosome 10 at 77,782,293 bp
  • T to C, chromosome 10 at 107,565,875 bp
  • T to C, chromosome 10 at 128,315,181 bp
  • A to C, chromosome 11 at 9,290,834 bp
  • A to G, chromosome 11 at 21,664,014 bp
  • T to C, chromosome 11 at 49,823,358 bp
  • C to T, chromosome 11 at 70,608,381 bp
  • G to A, chromosome 11 at 70,676,408 bp
  • T to G, chromosome 11 at 73,353,971 bp
  • T to C, chromosome 11 at 73,712,234 bp
  • G to A, chromosome 11 at 77,499,075 bp
  • A to T, chromosome 11 at 98,189,183 bp
  • C to T, chromosome 11 at 101,502,480 bp
  • T to C, chromosome 11 at 102,147,521 bp
  • A to T, chromosome 11 at 111,071,838 bp
  • T to C, chromosome 12 at 101,937,471 bp
  • G to T, chromosome 12 at 108,793,995 bp
  • G to T, chromosome 12 at 111,408,606 bp
  • T to C, chromosome 12 at 115,208,393 bp
  • G to T, chromosome 13 at 5,867,234 bp
  • C to T, chromosome 13 at 100,154,951 bp
  • T to C, chromosome 13 at 100,154,960 bp
  • A to T, chromosome 13 at 116,911,415 bp
  • A to G, chromosome 14 at 34,677,460 bp
  • T to G, chromosome 14 at 47,704,237 bp
  • C to T, chromosome 14 at 50,533,754 bp
  • G to A, chromosome 14 at 66,086,239 bp
  • A to G, chromosome 14 at 70,901,495 bp
  • T to A, chromosome 14 at 79,628,853 bp
  • T to C, chromosome 14 at 99,095,211 bp
  • G to A, chromosome 14 at 123,295,451 bp
  • A to T, chromosome 15 at 31,585,303 bp
  • A to G, chromosome 15 at 74,853,813 bp
  • G to A, chromosome 15 at 75,449,736 bp
  • C to T, chromosome 15 at 81,955,695 bp
  • A to C, chromosome 15 at 85,137,962 bp
  • G to A, chromosome 16 at 23,110,653 bp
  • A to C, chromosome 16 at 23,469,921 bp
  • T to C, chromosome 16 at 65,531,947 bp
  • T to C, chromosome 16 at 93,870,594 bp
  • T to C, chromosome 16 at 97,875,203 bp
  • A to G, chromosome 17 at 12,841,952 bp
  • A to T, chromosome 17 at 21,262,009 bp
  • C to A, chromosome 17 at 21,820,050 bp
  • G to A, chromosome 17 at 29,211,703 bp
  • C to T, chromosome 17 at 33,944,581 bp
  • A to T, chromosome 17 at 42,502,759 bp
  • A to G, chromosome 17 at 83,630,994 bp
  • T to C, chromosome 18 at 5,097,500 bp
  • A to T, chromosome 18 at 24,664,032 bp
  • T to A, chromosome 18 at 37,518,760 bp
  • A to G, chromosome 18 at 37,696,484 bp
  • G to A, chromosome 18 at 61,310,659 bp
  • T to C, chromosome 18 at 84,965,520 bp
  • T to A, chromosome 19 at 5,302,577 bp
  • A to G, chromosome 19 at 13,341,874 bp
  • T to A, chromosome 19 at 23,718,050 bp
  • A to G, chromosome 19 at 53,628,769 bp

Strain Description

Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.

Strain Origin

Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9072 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.

Appearance

Coat Color
Black

Breeding

MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain

Reproductive Statistics

Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Conditions of Distribution

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*		 Units Notes
068894-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.