Strain Name:
C57BL/6J-MtgxR9072Btlr/Mmmh
Stock Number:
068894-MU
Citation ID:
RRID:MMRRC_068894-MU
Other Names:
R9072 (G1)
Major Collection:

Strain Information

Nucb2
Name: nucleobindin 2
Synonyms: Calnuc, NEFA, nesfatin-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53322
HGNC: HGNC:8044
Homologene: 3676
Med1
Name: mediator complex subunit 1
Synonyms: Pparbp, TRAP 220, DRIP205, CRSP210, l11Jus15, PBP, TRAP220
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 19014
HGNC: HGNC:9234
Homologene: 21002
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Plcb4
Name: phospholipase C, beta 4
Synonyms: C230058B11Rik, A930039J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18798
HGNC: HGNC:9059
Homologene: 8471
Zdbf2
Name: zinc finger, DBF-type containing 2
Synonyms: 9330107J05Rik, 4930431J08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73884
Homologene: 52868
Ephx2
Name: epoxide hydrolase 2, cytoplasmic
Synonyms: sEH, sEP, Eph2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13850
VEGA: 14
HGNC: HGNC:3402
Homologene: 37558
Cyp11b2
Name: cytochrome P450, family 11, subfamily b, polypeptide 2
Synonyms: aldosterone synthase, Cyp11b-2, steroid-11-beta-hydroxylase, Cyp11b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13072
Homologene: 128035
Eif4a2
Name: eukaryotic translation initiation factor 4A2
Synonyms: Eif4, BM-010, Ddx2b, 4833432N07Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13682
HGNC: HGNC:3284
Homologene: 1487
Gfpt2
Name: glutamine fructose-6-phosphate transaminase 2
Synonyms: GFAT2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14584
HGNC: HGNC:4242
Homologene: 68439
Skap2
Name: src family associated phosphoprotein 2
Synonyms: RA70, SKAP-HOM, mSKAP55R, Saps, 2610021A10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54353
Homologene: 2919
Morc3
Name: microrchidia 3
Synonyms: D16Jhu32e, 1110051N18Rik, 1110051N18Rik, Zcwcc3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 338467
Homologene: 32257
Smc3
Name: structural maintenance of chromosomes 3
Synonyms: Mmip1, Bamacan, SmcD, Cspg6
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13006
HGNC: HGNC:2468
Homologene: 3974
Pan2
Name: PAN2 poly(A) specific ribonuclease subunit
Synonyms: 1200014O24Rik, Usp52
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103135
VEGA: 10
Homologene: 5918
Ccnb2
Name: cyclin B2
Synonyms: CycB2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12442
VEGA: 9
HGNC: HGNC:1580
Homologene: 74359
Sugt1
Name: SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)
Synonyms: SGT1, 2410174K12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67955
VEGA: 14
Homologene: 4877
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans), 2610207I05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Mcm5
Name: minichromosome maintenance complex component 5
Synonyms: mCD46, Cdc46, Mcmd5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17218
HGNC: HGNC:6948
Homologene: 4904
Fbxo15
Name: F-box protein 15
Synonyms: ecat3, Fbx15
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 50764
VEGA: 18
Homologene: 17644
Wapl
Name: WAPL cohesin release factor
Synonyms: A530089A20Rik, Wapal
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218914
Homologene: 41002
Atxn3
Name: ataxin 3
Synonyms: Mjd, Atx3, ataxin-3, Sca3, MJD1, 2210008M02Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 110616
HGNC: HGNC:7106
Homologene: 3658
Brca1
Name: breast cancer 1, early onset
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12189
HGNC: HGNC:1100
Homologene: 5276
Zbtb17
Name: zinc finger and BTB domain containing 17
Synonyms: Zfp100, Miz1, mZ13
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22642
Homologene: 2575
Mcm10
Name: minichromosome maintenance 10 replication initiation factor
Synonyms: C330019M07Rik, 2410041F14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70024
Homologene: 41275
Git1
Name: GIT ArfGAP 1
Synonyms: Cat-1, p95Cat
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216963
HGNC: HGNC:4272
Homologene: 32204
Wdr26
Name: WD repeat domain 26
Synonyms: Gid7, 1600024A01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226757
Homologene: 11857
Dis3
Name: DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease
Synonyms: 2810028N01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72662
VEGA: 14
Homologene: 6910
C2cd3
Name: C2 calcium-dependent domain containing 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277939
Homologene: 19524
Trak1
Name: trafficking protein, kinesin binding 1
Synonyms: 2310001H13Rik, hyrt
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67095
Homologene: 25103
Iqgap3
Name: IQ motif containing GTPase activating protein 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 404710
Homologene: 26400
Lbhd2
Name: LBH domain containing 2
Synonyms: LOC380787, Lbh2, A230065H16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380787
Homologene: 78587
Ube3b
Name: ubiquitin protein ligase E3B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117146
Homologene: 13775
Smap1
Name: small ArfGAP 1
Synonyms: 4921525H11Rik, 4921514B13Rik, 1700056O10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98366
Homologene: 134676
Map2
Name: microtubule-associated protein 2
Synonyms: Mtap2, G1-397-34, repro4, MAP-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17756
HGNC: HGNC:6839
Homologene: 1779
Yy1
Name: YY1 transcription factor
Synonyms: delta transcription factor, Yin Yang 1, UCRBP transcription factor, NF-E1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22632
Homologene: 2556
Ext2
Name: exostosin glycosyltransferase 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14043
HGNC: HGNC:3513
Homologene: 345
Aak1
Name: AP2 associated kinase 1
Synonyms: 5530400K14Rik, D6Ertd245e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269774
Homologene: 128746
Klf6
Name: Kruppel-like transcription factor 6
Synonyms: Zf9, CPBP, Copeb, FM6, FM2, BCD1, Ierepo3, Ierepo1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 23849
VEGA: 13
HGNC: HGNC:2235
Homologene: 996
Pmm1
Name: phosphomannomutase 1
Synonyms: Secp53 (yeast) homolog
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 29858
HGNC: HGNC:9114
Homologene: 90898
Cand2
Name: cullin associated and neddylation dissociated 2 (putative)
Synonyms: Tp120b, 2210404G23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67088
Homologene: 41657
Ankrd26
Name: ankyrin repeat domain 26
Synonyms: 5730521P14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232339
Homologene: 45968
Svil
Name: supervillin
Synonyms: B430302E16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225115
Homologene: 25090
Prkcb
Name: protein kinase C, beta
Synonyms: Prkcb2, PKC-Beta, Prkcb1, A130082F03Rik, Pkcb
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18751
HGNC: HGNC:9395
Homologene: 56424
Kcng3
Name: potassium voltage-gated channel, subfamily G, member 3
Synonyms: Kv10.1a, KV6.3, Kv10.1b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225030
VEGA: 17
Homologene: 15168
C1ql3
Name: C1q-like 3
Synonyms: K100, 1110065A22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227580
Homologene: 17701
Gfra2
Name: glial cell line derived neurotrophic factor family receptor alpha 2
Synonyms: GFR alpha-2, GFR alpha 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14586
VEGA: 14
HGNC: HGNC:4244
Homologene: 1145
Cpne5
Name: copine V
Synonyms: A830083G22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240058
HGNC: HGNC:2318
Homologene: 23266
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: 1700034M11Rik, hyrh, 4930545D19Rik, hy-3, hy3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Mocos
Name: molybdenum cofactor sulfurase
Synonyms: 1110018O12Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 68591
VEGA: 18
Homologene: 9931
Ttn
Name: titin
Synonyms: 2310036G12Rik, 2310057K23Rik, D330041I19Rik, mdm, connectin, D830007G01Rik, 1100001C23Rik, shru, 2310074I15Rik, L56
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Hmcn1
Name: hemicentin 1
Synonyms: EG545370, LOC240793
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Camta2
Name: calmodulin binding transcription activator 2
Synonyms: Kiaa0909-hp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216874
Homologene: 9021
Chn1
Name: chimerin 1
Synonyms: alpha1 chimaerin, 0710001E19Rik, 1700112L09Rik, alpha2 chimaerin, ARHGAP2, 0610007I19Rik, 2900046J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108699
HGNC: HGNC:1943
Homologene: 31056
Ptprq
Name: protein tyrosine phosphatase receptor type Q
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Col5a3
Name: collagen, type V, alpha 3
Synonyms: Pro-alpha3(V)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 53867
Homologene: 9253
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Birc1b, Naip2, Naip-rs6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Nwd1
Name: NACHT and WD repeat domain containing 1
Synonyms: A230063L24Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319555
Homologene: 72261
Nalcn
Name: sodium leak channel, non-selective
Synonyms: Vgcnl1, A530023G15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338370
VEGA: 14
Homologene: 21832
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Vmn1r73
Name: vomeronasal 1 receptor 73
Synonyms: V1rg2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 171237
Homologene: 103842
Hfm1
Name: HFM1, ATP-dependent DNA helicase homolog
Synonyms: LOC381663, A330009G12Rik, Sec63d1, Mer3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330149
Homologene: 87103
Mink1
Name: misshapen-like kinase 1 (zebrafish)
Synonyms: Misshapen/NIKs-related kinase, Map4k6, Ysk2, MINK
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 50932
Homologene: 56762
Ptchd4
Name: patched domain containing 4
Synonyms: 3110082D06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627626
VEGA: 17
Homologene: 78322
Plcb2
Name: phospholipase C, beta 2
Synonyms: B230205M18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18796
HGNC: HGNC:9055
Homologene: 20957
Trpc3
Name: transient receptor potential cation channel, subfamily C, member 3
Synonyms: Trcp3, Trp3, Trrp3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22065
Homologene: 20708
Ppargc1b
Name: peroxisome proliferative activated receptor, gamma, coactivator 1 beta
Synonyms: 4631412G21Rik, PGC-1beta/ERRL1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 170826
Homologene: 15776
Wdpcp
Name: WD repeat containing planar cell polarity effector
Synonyms: homoloc-13, AV249152
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216560
Homologene: 9299
Vsig8
Name: V-set and immunoglobulin domain containing 8
Synonyms: EG240916
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240916
Homologene: 18616
Agbl3
Name: ATP/GTP binding protein-like 3
Synonyms: 2900053G10Rik, 4930431N21Rik, 6530406M24Rik, Ccp3, Ccp3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76223
Homologene: 35330
Prg4
Name: proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
Synonyms: MSF, lubricin, SZP, DOL54
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 96875
HGNC: HGNC:9364
Homologene: 137352
Ccdc110
Name: coiled-coil domain containing 110
Synonyms: LOC212392
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212392
Homologene: 17668
Or11g27
Name: olfactory receptor family 11 subfamily G member 27
Synonyms: Olfr264, Olfr265, MOR106-8P, GA_x6K02T2PMLR-6243196-6244132, Olfr743, GA_x6K02T2N6FY-2320-2039, MOR106-14, GA_x6K02T2N6FY-3870-3385, Olfr743-ps1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219019
Homologene: 74163
Eeig1
Name: estrogen-induced osteoclastogenesis regulator 1
Synonyms: C230093N12Rik, Fam102a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98952
Homologene: 51943
Nlrp4b
Name: NLR family, pyrin domain containing 4B
Synonyms: Nalp-gamma, Nalp4b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210045
Homologene: 65242
Arid5a
Name: AT-rich interaction domain 5A
Synonyms: D430024K22Rik, Mrf1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214855
Homologene: 34940
Pcdhb22
Name: protocadherin beta 22
Synonyms: PcdhbV, Pcdhb15
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93893
HGNC: HGNC:8686
Homologene: 113752
Dcaf17
Name: DDB1 and CUL4 associated factor 17
Synonyms: A030004A10Rik, A930009G19Rik, 2810055O12Rik, 4833418A01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75763
Homologene: 65979
Kcnj2
Name: potassium inwardly-rectifying channel, subfamily J, member 2
Synonyms: Kcnf1, Kir2.1, IRK1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16518
HGNC: HGNC:6263
Homologene: 20249
Masp1
Name: MBL associated serine protease 1
Synonyms: Crarf
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17174
VEGA: 16
HGNC: HGNC:6901
Homologene: 88793
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: flamingo, Adgrc3, Fmi1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Zfp735
Name: zinc finger protein 735
Synonyms: 1700012C15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76390
Homologene: 88945
Olfm5
Name: olfactomedin 5
Synonyms: E030002O03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244180
Homologene: 18253
Ptar1
Name: protein prenyltransferase alpha subunit repeat containing 1
Synonyms: 2010013L17Rik, 4930428J16Rik, 1700084D09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72351
VEGA: 19
Homologene: 34254
Vmn1r235
Name: vomeronasal 1 receptor 235
Synonyms: V1rf2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171233
Homologene: 74360
Or2ag15
Name: olfactory receptor family 2 subfamily AG member 15
Synonyms: Olfr697, GA_x6K02T2PBJ9-9119301-9118348, MOR283-5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258592
Wdr46
Name: WD repeat domain 46
Synonyms: 2310007I04Rik, Bing4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57315
Homologene: 3981
Garin5b
Name: golgi associated RAB2 interactor family member 5B
Synonyms: 4930401F20Rik, Fam71e2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243822
Homologene: 89225
Zfp820
Name: zinc finger protein 820
Synonyms: 2610036F08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75424
VEGA: 17
Tinag
Name: tubulointerstitial nephritis antigen
Synonyms: TIN-ag
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 26944
Homologene: 8082
Or5d37
Name: olfactory receptor family 5 subfamily D member 37
Synonyms: Olfr1164, GA_x6K02T2Q125-49585842-49584862, MOR174-11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258634
Homologene: 74077
Nags
Name: N-acetylglutamate synthase
Synonyms: 1700120E20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217214
Homologene: 77363
Klhl35
Name: kelch-like 35
Synonyms: 2810406K13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72184
Homologene: 27849
Sgf29
Name: SAGA complex associated factor 29
Synonyms: Ccdc101, 1700023O11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75565
Homologene: 12607
Lrrc31
Name: leucine rich repeat containing 31
Synonyms: E230002P03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320352
Zfp819
Name: zinc finger protein 819
Synonyms: 4930427I11Rik, 4933405K07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74400
Homologene: 128446
Kbtbd12
Name: kelch repeat and BTB (POZ) domain containing 12
Synonyms: 4933428M03Rik, 4833415F11Rik, Klhdc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74589
Homologene: 52613
Ano3
Name: anoctamin 3
Synonyms: Tmem16c, B230324K02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228432
Homologene: 57147
Parp8
Name: poly (ADP-ribose) polymerase family, member 8
Synonyms: D13Ertd275e, 2810430O08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 52552
VEGA: 13
Homologene: 11621
Cmbl
Name: carboxymethylenebutenolidase homolog
Synonyms: 2310016A09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69574
Homologene: 100714
Cep250
Name: centrosomal protein 250
Synonyms: Cep2, B230210E21Rik, Inmp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16328
HGNC: HGNC:1859
Homologene: 38286
Vmn1r43
Name: vomeronasal 1 receptor 43
Synonyms: V1ra5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113847
Homologene: 130651
Cst5
Name: cystatin D
Synonyms: Cst10, DD72
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58214
HGNC: HGNC:2477
Homologene: 55615
Spred3
Name: sprouty-related EVH1 domain containing 3
Synonyms: D130060H24Rik, Spred-3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101809
Homologene: 28061
C2cd2
Name: C2 calcium-dependent domain containing 2
Synonyms: 5830404H04Rik, ORF25
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207781
VEGA: 16
HGNC: HGNC:1266
Homologene: 18368
Edem2
Name: ER degradation enhancer, mannosidase alpha-like 2
Synonyms: 9530090G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108687
Homologene: 10075
Slc27a3
Name: solute carrier family 27 (fatty acid transporter), member 3
Synonyms: Acsvl3, fatty acid transport protein 3, FATP3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26568
Homologene: 11529
Ribc2
Name: RIB43A domain with coiled-coils 2
Synonyms: 4930579A10Rik, Trib
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67747
VEGA: 15
Homologene: 9230
Or1e1
Name: olfactory receptor family 1 subfamily E member 1
Synonyms: MTPCR55, MTPCR06, GA_x6K02T2P1NL-3514066-3515010, MOR135-11, Olfr21, Olfr20
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258925
Homologene: 128054
Polr2l
Name: polymerase (RNA) II (DNA directed) polypeptide L
Synonyms: 2510029B14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66491
HGNC: HGNC:9199
Homologene: 129854
Or4k40
Name: olfactory receptor family 4 subfamily K member 40
Synonyms: Olfr1286, MOR248-21, GA_x6K02T2Q125-72472405-72471488
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 277562
Homologene: 73992
Sval1
Name: seminal vesicle antigen-like 1
Synonyms: 9130404C18Rik, SLP-C
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71578
Homologene: 87051
Mas1
Name: MAS1 oncogene
Synonyms: Mas-1, Mas receptor, MasR
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17171
HGNC: HGNC:6899
Homologene: 1782
Marchf8
Name: membrane associated ring-CH-type finger 8
Synonyms: Mir, 1300017E09Rik, March8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71779
Homologene: 12412
Or5b112
Name: olfactory receptor family 5 subfamily B member 112
Synonyms: MOR202-12, Olfr1466, GA_x6K02T2RE5P-3672907-3673839
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258689
HGNC: HGNC:8324
Homologene: 133677
Lonrf2
Name: LON peptidase N-terminal domain and ring finger 2
Synonyms: 2900060P06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381338
Homologene: 18871
Slc25a18
Name: solute carrier family 25 (mitochondrial carrier), member 18
Synonyms: 1500015I14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71803
Homologene: 57151
Best2
Name: bestrophin 2
Synonyms: Vmd2l1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212989
Homologene: 41187
Gfi1
Name: growth factor independent 1 transcription repressor
Synonyms: Gfi-1, Pal-1, Pal1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14581
HGNC: HGNC:4237
Homologene: 3854
Gal3st3
Name: galactose-3-O-sulfotransferase 3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 545276
VEGA: 19
Homologene: 57198
Or4c101
Name: olfactory receptor family 4 subfamily C member 101
Synonyms: GA_x6K02T2Q125-50046879-50047784, MOR238-2, Olfr1188
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258921
St6galnac5
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5
Synonyms: ST6GalNAc V, Siat7e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26938
Homologene: 8079
Or56b1
Name: olfactory receptor family 56 subfamily B member 1
Synonyms: MOR40-13, Olfr657, GA_x6K02T2PBJ9-7263864-7264823
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258309
Homologene: 17189
Pou1f1
Name: POU domain, class 1, transcription factor 1
Synonyms: Hmp1, GHF-1, Pit1, Pit-1, Pit1-rs1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 18736
HGNC: HGNC:9210
Homologene: 259
Tdpoz8
Name: TD and POZ domain containing 8
Synonyms: Gm4858
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229571
Homologene: 130121
Commd8
Name: COMM domain containing 8
Synonyms: D5Buc26e, IMAGE:1958590
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 27784
Homologene: 9873
Ly6l
Name: lymphocyte antigen 6 family member L
Synonyms: Gm20654
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 102637705
Homologene: 140539
Ptcd1
Name: pentatricopeptide repeat domain 1
Synonyms: 1110069M14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71799
Homologene: 33161
Pcdhga5
Name: protocadherin gamma subfamily A, 5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93713
HGNC: HGNC:8703
Homologene: 69263
Krtap10-23
Name: keratin associated protein 10-23
Synonyms: Gm3250
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100041281
VEGA: 10
Homologene: 115744
Spata19
Name: spermatogenesis associated 19
Synonyms: 1700001L23Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75469
VEGA: 9
Homologene: 12602
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 23,922,073 bp
  • A to G, chromosome 1 at 36,319,545 bp
  • A to T, chromosome 1 at 38,811,786 bp
  • T to C, chromosome 1 at 63,305,764 bp
  • C to A, chromosome 1 at 66,414,153 bp
  • G to T, chromosome 1 at 150,455,537 bp
  • A to T, chromosome 1 at 150,689,569 bp
  • A to T, chromosome 1 at 172,560,773 bp
  • A to T, chromosome 1 at 181,182,786 bp
  • G to A, chromosome 2 at 5,008,603 bp
  • T to A, chromosome 2 at 13,010,387 bp
  • A to G, chromosome 2 at 32,565,662 bp
  • G to A, chromosome 2 at 40,725,445 bp
  • T to C, chromosome 2 at 71,089,792 bp
  • T to C, chromosome 2 at 73,613,086 bp
  • C to T, chromosome 2 at 76,755,874 bp
  • ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG to ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG, chromosome 2 at 76,915,806 bp
  • T to C, chromosome 2 at 76,944,839 bp
  • T to A, chromosome 2 at 88,093,828 bp
  • A to C, chromosome 2 at 88,560,314 bp
  • A to G, chromosome 2 at 93,813,799 bp
  • T to A, chromosome 2 at 110,745,898 bp
  • A to T, chromosome 2 at 111,420,360 bp
  • G to A, chromosome 2 at 118,717,397 bp
  • A to G, chromosome 2 at 136,007,875 bp
  • A to G, chromosome 2 at 149,407,341 bp
  • G to C, chromosome 2 at 155,729,292 bp
  • C to G, chromosome 2 at 155,992,115 bp
  • T to C, chromosome 3 at 19,978,994 bp
  • T to C, chromosome 3 at 30,699,710 bp
  • T to C, chromosome 3 at 36,640,682 bp
  • G to A, chromosome 3 at 88,091,576 bp
  • A to G, chromosome 3 at 88,109,466 bp
  • A to C, chromosome 3 at 90,388,461 bp
  • T to A, chromosome 3 at 93,074,034 bp
  • T to C, chromosome 3 at 152,846,319 bp
  • T to C, chromosome 4 at 130,752,861 bp
  • C to A, chromosome 4 at 132,496,884 bp
  • T to A, chromosome 4 at 141,466,365 bp
  • T to C, chromosome 4 at 141,476,391 bp
  • TTGTCATCT to TT, chromosome 5 at 72,160,984 bp
  • T to C, chromosome 5 at 106,898,280 bp
  • T to A, chromosome 5 at 107,717,859 bp
  • C to T, chromosome 5 at 114,404,546 bp
  • T to A, chromosome 5 at 145,154,715 bp
  • T to C, chromosome 6 at 34,799,452 bp
  • T to C, chromosome 6 at 41,951,672 bp
  • C to T, chromosome 6 at 51,879,770 bp
  • T to A, chromosome 6 at 86,944,392 bp
  • T to C, chromosome 6 at 88,618,440 bp
  • G to A, chromosome 6 at 89,869,895 bp
  • C to T, chromosome 6 at 115,792,529 bp
  • T to C, chromosome 6 at 116,401,923 bp
  • T to A, chromosome 6 at 118,523,389 bp
  • C to T, chromosome 6 at 120,792,061 bp
  • A to T, chromosome 7 at 4,759,254 bp
  • A to G, chromosome 7 at 10,725,943 bp
  • C to T, chromosome 7 at 11,756,276 bp
  • G to A, chromosome 7 at 29,166,530 bp
  • C to A, chromosome 7 at 43,617,146 bp
  • A to T, chromosome 7 at 99,472,922 bp
  • T to G, chromosome 7 at 100,391,084 bp
  • A to G, chromosome 7 at 104,153,777 bp
  • C to T, chromosome 7 at 104,636,084 bp
  • A to T, chromosome 7 at 106,741,552 bp
  • T to A, chromosome 7 at 116,526,396 bp
  • C to T, chromosome 7 at 118,183,809 bp
  • T to A, chromosome 7 at 122,528,548 bp
  • G to A, chromosome 7 at 126,672,654 bp
  • T to C, chromosome 7 at 141,473,372 bp
  • A to T, chromosome 8 at 45,942,838 bp
  • A to T, chromosome 8 at 72,695,418 bp
  • G to A, chromosome 8 at 75,126,306 bp
  • T to A, chromosome 8 at 85,010,789 bp
  • G to A, chromosome 8 at 110,267,451 bp
  • T to A, chromosome 9 at 20,771,157 bp
  • T to G, chromosome 9 at 27,397,728 bp
  • T to A, chromosome 9 at 46,233,234 bp
  • A to T, chromosome 9 at 70,410,813 bp
  • T to A, chromosome 9 at 76,997,018 bp
  • G to A, chromosome 9 at 108,827,094 bp
  • T to C, chromosome 9 at 121,460,488 bp
  • A to T, chromosome 10 at 77,782,293 bp
  • T to C, chromosome 10 at 107,565,875 bp
  • T to C, chromosome 10 at 128,315,181 bp
  • A to C, chromosome 11 at 9,290,834 bp
  • A to G, chromosome 11 at 21,664,014 bp
  • T to C, chromosome 11 at 49,823,358 bp
  • C to T, chromosome 11 at 70,608,381 bp
  • G to A, chromosome 11 at 70,676,408 bp
  • T to G, chromosome 11 at 73,353,971 bp
  • T to C, chromosome 11 at 73,712,234 bp
  • G to A, chromosome 11 at 77,499,075 bp
  • A to T, chromosome 11 at 98,189,183 bp
  • C to T, chromosome 11 at 101,502,480 bp
  • T to C, chromosome 11 at 102,147,521 bp
  • A to T, chromosome 11 at 111,071,838 bp
  • T to C, chromosome 12 at 101,937,471 bp
  • G to T, chromosome 12 at 108,793,995 bp
  • G to T, chromosome 12 at 111,408,606 bp
  • T to C, chromosome 12 at 115,208,393 bp
  • G to T, chromosome 13 at 5,867,234 bp
  • C to T, chromosome 13 at 100,154,951 bp
  • T to C, chromosome 13 at 100,154,960 bp
  • A to T, chromosome 13 at 116,911,415 bp
  • A to G, chromosome 14 at 34,677,460 bp
  • T to G, chromosome 14 at 47,704,237 bp
  • C to T, chromosome 14 at 50,533,754 bp
  • G to A, chromosome 14 at 66,086,239 bp
  • A to G, chromosome 14 at 70,901,495 bp
  • T to A, chromosome 14 at 79,628,853 bp
  • T to C, chromosome 14 at 99,095,211 bp
  • G to A, chromosome 14 at 123,295,451 bp
  • A to T, chromosome 15 at 31,585,303 bp
  • A to G, chromosome 15 at 74,853,813 bp
  • G to A, chromosome 15 at 75,449,736 bp
  • C to T, chromosome 15 at 81,955,695 bp
  • A to C, chromosome 15 at 85,137,962 bp
  • G to A, chromosome 16 at 23,110,653 bp
  • A to C, chromosome 16 at 23,469,921 bp
  • T to C, chromosome 16 at 65,531,947 bp
  • T to C, chromosome 16 at 93,870,594 bp
  • T to C, chromosome 16 at 97,875,203 bp
  • A to G, chromosome 17 at 12,841,952 bp
  • A to T, chromosome 17 at 21,262,009 bp
  • C to A, chromosome 17 at 21,820,050 bp
  • G to A, chromosome 17 at 29,211,703 bp
  • C to T, chromosome 17 at 33,944,581 bp
  • A to T, chromosome 17 at 42,502,759 bp
  • A to G, chromosome 17 at 83,630,994 bp
  • T to C, chromosome 18 at 5,097,500 bp
  • A to T, chromosome 18 at 24,664,032 bp
  • T to A, chromosome 18 at 37,518,760 bp
  • A to G, chromosome 18 at 37,696,484 bp
  • G to A, chromosome 18 at 61,310,659 bp
  • T to C, chromosome 18 at 84,965,520 bp
  • T to A, chromosome 19 at 5,302,577 bp
  • A to G, chromosome 19 at 13,341,874 bp
  • T to A, chromosome 19 at 23,718,050 bp
  • A to G, chromosome 19 at 53,628,769 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9072 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068894-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.