Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9081Btlr/Mmmh
Stock Number:
068900-MU
Citation ID:
RRID:MMRRC_068900-MU
Other Names:
R9081 (G1)
Major Collection:

Strain Information

Kit
Name: KIT proto-oncogene receptor tyrosine kinase
Synonyms: Steel Factor Receptor, c-KIT, Dominant white spotting, belly-spot, Tr-kit, SOW3, SCO5, SCO1, Gsfsow3, Gsfsco5, Gsfsco1, CD117
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Hgs
Name: HGF-regulated tyrosine kinase substrate
Synonyms: Hrs, tn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15239
HGNC: HGNC:4897
Homologene: 37954
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Eps8
Name: epidermal growth factor receptor pathway substrate 8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13860
HGNC: HGNC:3420
Homologene: 3272
Egln2
Name: egl-9 family hypoxia-inducible factor 2
Synonyms: SM-20, Ier4, 0610011A13Rik, Phd1, Hif-p4h-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 112406
Homologene: 14204
Fbxo31
Name: F-box protein 31
Synonyms: 2310046N15Rik, Fbx14, Fbxo14, 1110003O08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76454
Homologene: 11684
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 44,114,806 bp
  • A to T, chromosome 1 at 75,314,416 bp
  • C to T, chromosome 1 at 94,041,155 bp
  • A to G, chromosome 1 at 127,759,731 bp
  • C to T, chromosome 1 at 134,777,347 bp
  • A to G, chromosome 1 at 173,929,482 bp
  • A to T, chromosome 2 at 32,687,488 bp
  • T to G, chromosome 2 at 33,006,908 bp
  • C to T, chromosome 2 at 52,110,977 bp
  • C to T, chromosome 2 at 69,292,044 bp
  • A to T, chromosome 2 at 102,611,588 bp
  • T to A, chromosome 2 at 148,683,397 bp
  • A to T, chromosome 2 at 180,192,137 bp
  • A to G, chromosome 3 at 32,881,393 bp
  • A to T, chromosome 3 at 96,032,813 bp
  • A to G, chromosome 3 at 96,919,360 bp
  • A to G, chromosome 4 at 53,109,162 bp
  • T to C, chromosome 4 at 135,376,981 bp
  • G to T, chromosome 4 at 136,938,586 bp
  • A to G, chromosome 4 at 156,241,767 bp
  • A to T, chromosome 5 at 75,640,558 bp
  • A to G, chromosome 5 at 107,815,705 bp
  • T to C, chromosome 6 at 83,048,657 bp
  • A to G, chromosome 6 at 137,527,417 bp
  • G to A, chromosome 7 at 20,534,453 bp
  • A to G, chromosome 7 at 27,164,861 bp
  • A to G, chromosome 7 at 44,225,528 bp
  • C to T, chromosome 7 at 45,684,563 bp
  • A to G, chromosome 7 at 65,314,262 bp
  • A to G, chromosome 7 at 105,754,429 bp
  • T to A, chromosome 8 at 13,018,697 bp
  • G to A, chromosome 8 at 75,051,523 bp
  • T to G, chromosome 8 at 83,426,540 bp
  • A to T, chromosome 8 at 90,977,516 bp
  • G to A, chromosome 8 at 121,554,397 bp
  • A to T, chromosome 9 at 39,646,900 bp
  • G to A, chromosome 10 at 24,037,995 bp
  • C to T, chromosome 10 at 28,668,586 bp
  • T to C, chromosome 10 at 59,348,363 bp
  • T to C, chromosome 10 at 77,041,916 bp
  • T to C, chromosome 10 at 79,626,928 bp
  • T to G, chromosome 10 at 88,553,306 bp
  • T to C, chromosome 11 at 35,891,504 bp
  • A to T, chromosome 11 at 53,871,621 bp
  • A to C, chromosome 11 at 62,119,225 bp
  • G to A, chromosome 11 at 77,974,295 bp
  • T to G, chromosome 11 at 101,425,227 bp
  • G to A, chromosome 11 at 102,674,175 bp
  • T to A, chromosome 11 at 114,738,667 bp
  • T to A, chromosome 11 at 115,394,113 bp
  • A to T, chromosome 11 at 119,466,236 bp
  • T to A, chromosome 11 at 120,475,250 bp
  • C to T, chromosome 12 at 75,969,516 bp
  • T to C, chromosome 12 at 85,139,107 bp
  • C to A, chromosome 12 at 115,802,834 bp
  • A to T, chromosome 13 at 49,661,405 bp
  • CAGAGACCGGGACAGAAGGAGAGAC to CAGAGAC, chromosome 14 at 75,331,941 bp
  • A to G, chromosome 14 at 87,506,281 bp
  • T to A, chromosome 15 at 55,427,991 bp
  • A to G, chromosome 15 at 76,175,708 bp
  • C to T, chromosome 15 at 77,640,571 bp
  • A to T, chromosome 15 at 91,191,569 bp
  • C to T, chromosome 15 at 101,532,379 bp
  • A to T, chromosome 15 at 102,340,067 bp
  • A to G, chromosome 16 at 36,835,644 bp
  • G to T, chromosome 16 at 93,610,106 bp
  • T to C, chromosome 17 at 46,430,033 bp
  • T to C, chromosome 17 at 47,673,311 bp
  • A to T, chromosome 18 at 42,648,760 bp
  • T to A, chromosome 19 at 9,008,526 bp
  • C to T, chromosome 19 at 13,364,655 bp
  • A to T, chromosome 19 at 58,734,974 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9081 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068900-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.