Strain Name:
C57BL/6J-MtgxR9081Btlr/Mmmh
Stock Number:
068900-MU
Citation ID:
RRID:MMRRC_068900-MU
Other Names:
R9081 (G1)
Major Collection:

Strain Information

Kit
Name: KIT proto-oncogene receptor tyrosine kinase
Synonyms: CD117, Gsfsco5, belly-spot, Tr-kit, Gsfsow3, SCO5, Gsfsco1, c-KIT, Steel Factor Receptor, Dominant white spotting, SCO1, SOW3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Hgs
Name: HGF-regulated tyrosine kinase substrate
Synonyms: tn, Hrs
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15239
HGNC: HGNC:4897
Homologene: 37954
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Eps8
Name: epidermal growth factor receptor pathway substrate 8
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13860
HGNC: HGNC:3420
Homologene: 3272
Egln2
Name: egl-9 family hypoxia-inducible factor 2
Synonyms: 0610011A13Rik, SM-20, Ier4, Hif-p4h-1, Phd1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 112406
Homologene: 14204
Fbxo31
Name: F-box protein 31
Synonyms: Fbx14, 2310046N15Rik, Fbxo14, 1110003O08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76454
Homologene: 11684
Zc3h13
Name: zinc finger CCCH type containing 13
Synonyms: C87618, 4930570G11Rik, 2600010B19Rik, 3110050K21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67302
VEGA: 14
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 9030205D12Rik, AD013, A330063D19Rik, 1810014J18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Evi5
Name: ecotropic viral integration site 5
Synonyms: NB4S
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14020
HGNC: HGNC:3501
Homologene: 121902
Tdrd3
Name: tudor domain containing 3
Synonyms: 4732418C03Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219249
Homologene: 12771
Epha8
Name: Eph receptor A8
Synonyms: EphA8, Hek3, Eek
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13842
HGNC: HGNC:3391
Homologene: 22436
Abca1
Name: ATP-binding cassette, sub-family A member 1
Synonyms: ABC1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11303
HGNC: HGNC:29
Homologene: 21130
Rif1
Name: replication timing regulatory factor 1
Synonyms: D2Ertd145e, 5730435J01Rik, 6530403D07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 51869
Homologene: 41231
Wwc1
Name: WW, C2 and coiled-coil domain containing 1
Synonyms: Kibra
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 211652
Homologene: 69180
Gja8
Name: gap junction protein, alpha 8
Synonyms: Lop10, connexin 50, dcm, Cnx50, Cx50, Aey5, alpha 8 connexin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14616
HGNC: HGNC:4281
Homologene: 3857
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Tjp1
Name: tight junction protein 1
Synonyms: ZO-1, ZO1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21872
Homologene: 2445
Mcf2l
Name: mcf.2 transforming sequence-like
Synonyms: C130040G20Rik, Dbs
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17207
Homologene: 11804
Themis
Name: thymocyte selection associated
Synonyms: E430004N04Rik, Gasp, Tsepa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 210757
Homologene: 72287
Sec1
Name: secretory blood group 1
Synonyms: Fut3, GDP-L-fucose:beta-D-galactoside 2-alpha-L-fucosyltransferase FUT-III
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56546
Homologene: 431
Pamr1
Name: peptidase domain containing associated with muscle regeneration 1
Synonyms: RAMP, E430002G05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 210622
Homologene: 9134
Tom1
Name: target of myb1 trafficking protein
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21968
Homologene: 88453
Nol8
Name: nucleolar protein 8
Synonyms: D13Ertd548e, 5730412B09Rik, 4921532D18Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 70930
VEGA: 13
Homologene: 41210
Gzf1
Name: GDNF-inducible zinc finger protein 1
Synonyms: 8430437G08Rik, Zfp336
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74533
Homologene: 11200
Garnl3
Name: GTPase activating RANGAP domain-like 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99326
Homologene: 13003
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 9530009M10Rik, 1810037O03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Iqcb1
Name: IQ calmodulin-binding motif containing 1
Synonyms: NPHP5, 6820449I09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 320299
Homologene: 8766
Rundc1
Name: RUN domain containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217201
Homologene: 15095
Pdcd1
Name: programmed cell death 1
Synonyms: Pdc1, PD-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18566
HGNC: HGNC:8760
Homologene: 3681
Dchs1
Name: dachsous cadherin related 1
Synonyms: 3110041P15Rik, C130033F22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233651
Homologene: 2771
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: syne-2, 6820443O06Rik, D12Ertd777e, nesprin-2, Cpfl8, Nesp2g, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 672511
Homologene: 45439
Klk1
Name: kallikrein 1
Synonyms: Klk6, 0610007D04Rik, mGk-6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16612
Homologene: 68141
Crip3
Name: cysteine-rich protein 3
Synonyms: TLP-A, TLP
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 114570
Homologene: 28039
Abcb11
Name: ATP-binding cassette, sub-family B member 11
Synonyms: Lith1, PGY4, sister of P-glycoprotein, Bsep, ABC16, PFIC2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Specc1
Name: sperm antigen with calponin homology and coiled-coil domains 1
Synonyms: B230396K10Rik, Cytsb, 2810012G08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432572
Homologene: 45157
Col14a1
Name: collagen, type XIV, alpha 1
Synonyms: 5730412L22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12818
HGNC: HGNC:2191
Homologene: 18741
Ahnak
Name: AHNAK nucleoprotein
Synonyms: 2310047C17Rik, DY6, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Slc22a5
Name: solute carrier family 22 (organic cation transporter), member 5
Synonyms: Octn2, Lstpl
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20520
Homologene: 68295
Shc2
Name: SHC (Src homology 2 domain containing) transforming protein 2
Synonyms: ShcB, Sli
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216148
Homologene: 19127
Dnai2
Name: dynein axonemal intermediate chain 2
Synonyms: C030015H18Rik, b2b3405Clo, Dnaic2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432611
Homologene: 11311
Mybpc1
Name: myosin binding protein C, slow-type
Synonyms: 8030451F13Rik, Slow-type C-protein
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 109272
HGNC: HGNC:7549
Homologene: 1846
Krt84
Name: keratin 84
Synonyms: HRb-1, Krt2-3, Krt2-16
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16680
VEGA: 15
HGNC: HGNC:6461
Homologene: 22473
Slc19a1
Name: solute carrier family 19 (folate transporter), member 1
Synonyms: RFC1, RFC-1, reduced folate carrier
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20509
Homologene: 57139
Usp13
Name: ubiquitin specific peptidase 13 (isopeptidase T-3)
Synonyms: IsoT-3, ISOT3, 2700071E21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72607
Homologene: 68372
Cbr1
Name: carbonyl reductase 1
Synonyms: CR
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12408
HGNC: HGNC:1548
Homologene: 37524
Cdr2l
Name: cerebellar degeneration-related protein 2-like
Synonyms: D030068L24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237988
Homologene: 35390
P4ha1
Name: procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide
Synonyms: P4ha
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18451
HGNC: HGNC:8546
Homologene: 30998
Loxl3
Name: lysyl oxidase-like 3
Synonyms: Lor2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16950
Homologene: 56591
Fpgs
Name: folylpolyglutamyl synthetase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14287
HGNC: HGNC:3824
Homologene: 6997
Meioc
Name: meiosis specific with coiled-coil domain
Synonyms: Gm1564, LOC268491, LOC380729
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268491
Homologene: 19559
Or10d4c
Name: olfactory receptor family 10 subfamily D member 4C
Synonyms: GA_x6K02T2PVTD-33343617-33344561, Olfr961, MOR224-5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258497
VEGA: 9
Homologene: 74020
Or5b113
Name: olfactory receptor family 5 subfamily B member 113
Synonyms: Olfr1467, GA_x6K02T2RE5P-3695694-3696620, MOR202-15
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258686
Homologene: 133888
Abcd2
Name: ATP-binding cassette, sub-family D member 2
Synonyms: adrenoleukodystrophy related, ABC39, ALDL1, ALDR
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 26874
VEGA: 15
HGNC: HGNC:66
Homologene: 55873
Pnliprp1
Name: pancreatic lipase related protein 1
Synonyms: Plrp1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18946
VEGA: 19
HGNC: HGNC:9156
Homologene: 21253
Poglut2
Name: protein O-glucosyltransferase 2
Synonyms: EP58, Kdelc1, 1810049A15Rik, Kdel1, 5730416C13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72050
Homologene: 11367
Acmsd
Name: amino carboxymuconate semialdehyde decarboxylase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 266645
Homologene: 44520
Clgn
Name: calmegin
Synonyms: A2/6, calnexin-t, 4930459O04Rik, Cln
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12745
HGNC: HGNC:2060
Homologene: 68392
Usp49
Name: ubiquitin specific peptidase 49
Synonyms: C330046L10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224836
Homologene: 10235
Ppp2r2b
Name: protein phosphatase 2, regulatory subunit B, beta
Synonyms: PR55-BETA, SCA12, 6330404L05Rik, E130009M08Rik, PP2A-PR55B, 2900026H06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72930
HGNC: HGNC:9305
Homologene: 55833
Vps45
Name: vacuolar protein sorting 45
Synonyms: mVps45
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22365
Homologene: 5250
Aaas
Name: achalasia, adrenocortical insufficiency, alacrimia
Synonyms: D030041N15Rik, GL003, Aladin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223921
VEGA: 15
Homologene: 9232
Rps6kl1
Name: ribosomal protein S6 kinase-like 1
Synonyms: A830084F09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238323
VEGA: 12
Homologene: 12874
Apol11b
Name: apolipoprotein L 11b
Synonyms: A330102K04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328563
Homologene: 129975
Taar7e
Name: trace amine-associated receptor 7E
Synonyms: LOC276742
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 276742
Homologene: 134040
Noc2l
Name: NOC2 like nucleolar associated transcriptional repressor
Synonyms: NIR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 57741
VEGA: 4
Homologene: 6980
Ncmap
Name: noncompact myelin associated protein
Synonyms: A330049M08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230822
Homologene: 27072
Vmn1r104
Name: vomeronasal 1 receptor 104
Synonyms: Gm8477
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667135
Homologene: 104166
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 44,114,806 bp
  • A to T, chromosome 1 at 75,314,416 bp
  • C to T, chromosome 1 at 94,041,155 bp
  • A to G, chromosome 1 at 127,759,731 bp
  • C to T, chromosome 1 at 134,777,347 bp
  • A to G, chromosome 1 at 173,929,482 bp
  • A to T, chromosome 2 at 32,687,488 bp
  • T to G, chromosome 2 at 33,006,908 bp
  • C to T, chromosome 2 at 52,110,977 bp
  • C to T, chromosome 2 at 69,292,044 bp
  • A to T, chromosome 2 at 102,611,588 bp
  • T to A, chromosome 2 at 148,683,397 bp
  • A to T, chromosome 2 at 180,192,137 bp
  • A to G, chromosome 3 at 32,881,393 bp
  • A to T, chromosome 3 at 96,032,813 bp
  • A to G, chromosome 3 at 96,919,360 bp
  • A to G, chromosome 4 at 53,109,162 bp
  • T to C, chromosome 4 at 135,376,981 bp
  • G to T, chromosome 4 at 136,938,586 bp
  • A to G, chromosome 4 at 156,241,767 bp
  • A to T, chromosome 5 at 75,640,558 bp
  • A to G, chromosome 5 at 107,815,705 bp
  • T to C, chromosome 6 at 83,048,657 bp
  • A to G, chromosome 6 at 137,527,417 bp
  • G to A, chromosome 7 at 20,534,453 bp
  • A to G, chromosome 7 at 27,164,861 bp
  • A to G, chromosome 7 at 44,225,528 bp
  • C to T, chromosome 7 at 45,684,563 bp
  • A to G, chromosome 7 at 65,314,262 bp
  • A to G, chromosome 7 at 105,754,429 bp
  • T to A, chromosome 8 at 13,018,697 bp
  • G to A, chromosome 8 at 75,051,523 bp
  • T to G, chromosome 8 at 83,426,540 bp
  • A to T, chromosome 8 at 90,977,516 bp
  • G to A, chromosome 8 at 121,554,397 bp
  • A to T, chromosome 9 at 39,646,900 bp
  • G to A, chromosome 10 at 24,037,995 bp
  • C to T, chromosome 10 at 28,668,586 bp
  • T to C, chromosome 10 at 59,348,363 bp
  • T to C, chromosome 10 at 77,041,916 bp
  • T to C, chromosome 10 at 79,626,928 bp
  • T to G, chromosome 10 at 88,553,306 bp
  • T to C, chromosome 11 at 35,891,504 bp
  • A to T, chromosome 11 at 53,871,621 bp
  • A to C, chromosome 11 at 62,119,225 bp
  • G to A, chromosome 11 at 77,974,295 bp
  • T to G, chromosome 11 at 101,425,227 bp
  • G to A, chromosome 11 at 102,674,175 bp
  • T to A, chromosome 11 at 114,738,667 bp
  • T to A, chromosome 11 at 115,394,113 bp
  • A to T, chromosome 11 at 119,466,236 bp
  • T to A, chromosome 11 at 120,475,250 bp
  • C to T, chromosome 12 at 75,969,516 bp
  • T to C, chromosome 12 at 85,139,107 bp
  • C to A, chromosome 12 at 115,802,834 bp
  • A to T, chromosome 13 at 49,661,405 bp
  • CAGAGACCGGGACAGAAGGAGAGAC to CAGAGAC, chromosome 14 at 75,331,941 bp
  • A to G, chromosome 14 at 87,506,281 bp
  • T to A, chromosome 15 at 55,427,991 bp
  • A to G, chromosome 15 at 76,175,708 bp
  • C to T, chromosome 15 at 77,640,571 bp
  • A to T, chromosome 15 at 91,191,569 bp
  • C to T, chromosome 15 at 101,532,379 bp
  • A to T, chromosome 15 at 102,340,067 bp
  • A to G, chromosome 16 at 36,835,644 bp
  • G to T, chromosome 16 at 93,610,106 bp
  • T to C, chromosome 17 at 46,430,033 bp
  • T to C, chromosome 17 at 47,673,311 bp
  • A to T, chromosome 18 at 42,648,760 bp
  • T to A, chromosome 19 at 9,008,526 bp
  • C to T, chromosome 19 at 13,364,655 bp
  • A to T, chromosome 19 at 58,734,974 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9081 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068900-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.