Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9086Btlr/Mmmh
Stock Number:
068905-MU
Citation ID:
RRID:MMRRC_068905-MU
Other Names:
R9086 (G1)
Major Collection:

Strain Information

Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Por
Name: cytochrome p450 oxidoreductase
Synonyms: NADH cytochrome P450 oxydoreductase, CYPOR, CPR, 4933424M13Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18984
HGNC: HGNC:9208
Homologene: 725
Ctdspl2
Name: CTD small phosphatase like 2
Synonyms: D2Ertd485e, SCP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329506
Homologene: 32311
Stk11ip
Name: serine/threonine kinase 11 interacting protein
Synonyms: LKB1IP, LIP1, 1200014D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71728
Homologene: 12406
Mthfd1l
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Synonyms: 2410004L15Rik, Fthfsdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270685
Homologene: 56706
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 20,955,368 bp
  • A to G, chromosome 1 at 75,530,174 bp
  • A to T, chromosome 2 at 25,039,697 bp
  • T to C, chromosome 2 at 32,572,379 bp
  • T to A, chromosome 2 at 37,146,414 bp
  • T to A, chromosome 2 at 58,790,165 bp
  • A to G, chromosome 2 at 66,351,014 bp
  • TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT to TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT, chromosome 2 at 121,397,572 bp
  • G to A, chromosome 2 at 122,007,817 bp
  • A to G, chromosome 2 at 122,301,340 bp
  • A to G, chromosome 2 at 164,290,142 bp
  • A to C, chromosome 3 at 14,887,908 bp
  • A to C, chromosome 3 at 57,833,576 bp
  • T to C, chromosome 4 at 15,266,718 bp
  • C to T, chromosome 4 at 108,169,879 bp
  • T to A, chromosome 4 at 123,484,151 bp
  • T to A, chromosome 4 at 133,260,864 bp
  • T to C, chromosome 5 at 64,925,855 bp
  • T to C, chromosome 5 at 67,774,816 bp
  • T to A, chromosome 5 at 105,218,503 bp
  • A to T, chromosome 5 at 130,211,951 bp
  • T to C, chromosome 5 at 135,231,684 bp
  • G to T, chromosome 5 at 135,716,064 bp
  • A to T, chromosome 5 at 139,758,192 bp
  • A to G, chromosome 7 at 13,337,767 bp
  • T to A, chromosome 7 at 16,090,404 bp
  • T to C, chromosome 7 at 27,036,519 bp
  • A to T, chromosome 7 at 106,805,919 bp
  • T to C, chromosome 7 at 137,199,265 bp
  • C to A, chromosome 7 at 141,259,499 bp
  • C to A, chromosome 8 at 13,939,621 bp
  • T to C, chromosome 8 at 23,099,620 bp
  • T to A, chromosome 8 at 106,015,941 bp
  • C to T, chromosome 9 at 43,111,369 bp
  • A to T, chromosome 10 at 3,973,412 bp
  • G to T, chromosome 10 at 41,285,403 bp
  • T to C, chromosome 10 at 81,240,195 bp
  • C to T, chromosome 10 at 82,288,743 bp
  • G to A, chromosome 10 at 116,939,405 bp
  • C to A, chromosome 11 at 23,665,760 bp
  • T to C, chromosome 11 at 50,237,247 bp
  • T to A, chromosome 11 at 58,702,129 bp
  • A to T, chromosome 11 at 94,968,257 bp
  • A to T, chromosome 11 at 109,675,928 bp
  • T to C, chromosome 11 at 110,102,053 bp
  • A to G, chromosome 12 at 83,774,859 bp
  • G to A, chromosome 12 at 85,917,742 bp
  • A to T, chromosome 12 at 86,024,333 bp
  • T to A, chromosome 12 at 102,492,217 bp
  • G to A, chromosome 12 at 112,679,414 bp
  • A to G, chromosome 13 at 6,577,481 bp
  • A to G, chromosome 13 at 37,983,473 bp
  • T to A, chromosome 13 at 38,022,922 bp
  • T to A, chromosome 13 at 64,781,759 bp
  • T to A, chromosome 14 at 33,932,264 bp
  • A to G, chromosome 14 at 51,104,972 bp
  • A to G, chromosome 15 at 4,953,272 bp
  • A to G, chromosome 15 at 8,148,346 bp
  • A to G, chromosome 15 at 91,755,848 bp
  • C to A, chromosome 16 at 32,757,468 bp
  • A to G, chromosome 16 at 48,961,130 bp
  • T to A, chromosome 16 at 91,670,530 bp
  • A to G, chromosome 17 at 90,162,364 bp
  • T to C, chromosome 18 at 11,742,679 bp
  • T to C, chromosome 18 at 46,932,594 bp
  • T to C, chromosome 19 at 4,152,526 bp
  • A to T, chromosome 19 at 4,159,271 bp
  • G to A, chromosome 19 at 6,490,078 bp
  • C to A, chromosome 19 at 8,735,994 bp
  • A to T, chromosome 19 at 33,557,129 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9086 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068905-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.