Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9086Btlr/Mmmh
Stock Number:
068905-MU
Citation ID:
RRID:MMRRC_068905-MU
Other Names:
R9086 (G1)
Major Collection:

Strain Information

Nrxn2
Name: neurexin II
Synonyms: neurexin II beta, neurexin II alpha, 6430591O13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18190
HGNC: HGNC:8009
Homologene: 86984
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Nup155
Name: nucleoporin 155
Synonyms: D930027M19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 170762
VEGA: 15
HGNC: HGNC:8063
Homologene: 43155
Por
Name: cytochrome p450 oxidoreductase
Synonyms: NADH cytochrome P450 oxydoreductase, CYPOR, CPR, 4933424M13Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18984
HGNC: HGNC:9208
Homologene: 725
Ctdspl2
Name: CTD small phosphatase like 2
Synonyms: D2Ertd485e, SCP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329506
Homologene: 32311
Stk11ip
Name: serine/threonine kinase 11 interacting protein
Synonyms: LKB1IP, LIP1, 1200014D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71728
Homologene: 12406
Mthfd1l
Name: methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Synonyms: 2410004L15Rik, Fthfsdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 270685
Homologene: 56706
Baz1b
Name: bromodomain adjacent to zinc finger domain, 1B
Synonyms: Wbscr9, WSTF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22385
HGNC: HGNC:961
Homologene: 22651
Ints1
Name: integrator complex subunit 1
Synonyms: 1110015K06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68510
Homologene: 53111
Golga5
Name: golgin A5
Synonyms: Ret-II
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 27277
VEGA: 12
HGNC: HGNC:4428
Homologene: 38009
Gdf10
Name: growth differentiation factor 10
Synonyms: Bmp3b
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14560
VEGA: 14
HGNC: HGNC:4215
Homologene: 3640
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Rab3ip
Name: RAB3A interacting protein
Synonyms: Gtpat12, SSX2 interacting protein, Rabin3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216363
VEGA: 10
Homologene: 32340
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: cI-46, LOC381026, 9330188B09Rik, D630001M17Rik, 4921513O20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66725
Homologene: 18982
Dzip3
Name: DAZ interacting protein 3, zinc finger
Synonyms: 6430549P11Rik, 2310047C04Rik, 2A-HUB
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224170
Homologene: 8771
Phrf1
Name: PHD and ring finger domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101471
Homologene: 16377
Echdc2
Name: enoyl Coenzyme A hydratase domain containing 2
Synonyms: 1300017C12Rik, 2610009M20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 52430
Homologene: 23088
Ebf3
Name: early B cell factor 3
Synonyms: O/E-2, Olf-1/EBF-like 2, 3110018A08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13593
Homologene: 56472
Rnf13
Name: ring finger protein 13
Synonyms: Rzf, 2010001H16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 24017
Homologene: 13493
Rabgef1
Name: RAB guanine nucleotide exchange factor (GEF) 1
Synonyms: Ras negative regulator Rabex-5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56715
Homologene: 8720
Tmem64
Name: transmembrane protein 64
Synonyms: 9630015D15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100201
Homologene: 45636
Pnpla7
Name: patatin-like phospholipase domain containing 7
Synonyms: E430013P11Rik, NRE
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241274
Homologene: 62431
Papln
Name: papilin, proteoglycan-like sulfated glycoprotein
Synonyms: E030033C16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 170721
Homologene: 71541
Ttll5
Name: tubulin tyrosine ligase-like family, member 5
Synonyms: 4930556H18Rik, 1700048H13Rik, 2310009M18Rik, D630041K24Rik, STAMP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320244
Homologene: 9013
Scn1a
Name: sodium channel, voltage-gated, type I, alpha
Synonyms: Nav1.1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20265
Homologene: 21375
Fig4
Name: FIG4 phosphoinositide 5-phosphatase
Synonyms: A530089I17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103199
VEGA: 10
Homologene: 6713
Efhc1
Name: EF-hand domain (C-terminal) containing 1
Synonyms: 1700029F22Rik, mRib72-1, myoclonin1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71877
Homologene: 10003
Fam20a
Name: FAM20A, golgi associated secretory pathway pseudokinase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 208659
Homologene: 9719
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Mroh2b
Name: maestro heat-like repeat family member 2B
Synonyms: 4930455B06Rik, Heatr7b2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223825
VEGA: 15
Homologene: 128807
Abca9
Name: ATP-binding cassette, sub-family A member 9
Synonyms: D630040K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217262
HGNC: HGNC:39
Homologene: 33332
Rbbp8
Name: retinoblastoma binding protein 8, endonuclease
Synonyms: 9930104E21Rik, CtIP
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225182
VEGA: 18
HGNC: HGNC:9891
Homologene: 28546
Pitrm1
Name: pitrilysin metallepetidase 1
Synonyms: MP-1, 2310012C15Rik, Ntup1, PreP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69617
VEGA: 13
Homologene: 5742
Zfp541
Name: zinc finger protein 541
Synonyms: EG666528
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 666528
Homologene: 12991
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Nrxn1
Name: neurexin I
Synonyms: alpha-latrotoxin receptor (calcium-dependent), neurexin I beta, neurexin I alpha, neurexin I beta, neurexin I beta, neurexin I alpha, neurexin I alpha, 1700062G21Rik, A230068P09Rik, 9330127H16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18189
HGNC: HGNC:8008
Homologene: 21005
Lipo3
Name: lipase, member O3
Synonyms: Lipo1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381236
Homologene: 103863
Pla2g4c
Name: phospholipase A2, group IVC (cytosolic, calcium-independent)
Synonyms: CPLA2-gamma
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232889
HGNC: HGNC:9037
Homologene: 115256
Coro1b
Name: coronin, actin binding protein 1B
Synonyms: coronin 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 23789
HGNC: HGNC:2253
Homologene: 40790
Atp8a1
Name: ATPase phospholipid transporting 8A1
Synonyms: Atp3a2, B230107D19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11980
Homologene: 48402
Sytl1
Name: synaptotagmin-like 1
Synonyms: Slp1, PSGL-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269589
Homologene: 12853
Car2
Name: carbonic anhydrase 2
Synonyms: CAII, CA II, Ltw-5, Car-2, Lvtw-5
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12349
HGNC: HGNC:1373
Homologene: 37256
Zfr2
Name: zinc finger RNA binding protein 2
Synonyms: 2010013I23Rik, 9130206N08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103406
Homologene: 88124
Cntnap3
Name: contactin associated protein-like 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238680
VEGA: 13
Homologene: 129602
Tlr1
Name: toll-like receptor 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21897
Homologene: 20694
Gbp10
Name: guanylate-binding protein 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 626578
Homologene: 128731
Tlcd5
Name: TLC domain containing 5
Synonyms: LOC235300, Tmem136
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235300
VEGA: 9
Homologene: 72560
Dus2
Name: dihydrouridine synthase 2
Synonyms: 2310016K04Rik, Dus2l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66369
Homologene: 6838
Pex13
Name: peroxisomal biogenesis factor 13
Synonyms: 2610008O20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72129
HGNC: HGNC:8855
Homologene: 1967
Or2ak6
Name: olfactory receptor family 2 subfamily AK member 6
Synonyms: GA_x6K02T2NKPP-708319-707399, MOR285-2, Olfr319
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258493
Svs3a
Name: seminal vesicle secretory protein 3A
Synonyms: Svp-3, 9530026M05Rik, Svp3, SVS III, Svs3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 64335
Homologene: 110771
Cage1
Name: cancer antigen 1
Synonyms: CAGE1, 4933427I01Rik, Ctag3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71213
Homologene: 18484
Or2ag18
Name: olfactory receptor family 2 subfamily AG member 18
Synonyms: GA_x6K02T2PBJ9-9184187-9183237, MOR283-4, Olfr700
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258593
Homologene: 64895
Arl14epl
Name: ADP-ribosylation factor-like 14 effector protein-like
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381142
VEGA: 18
Homologene: 85362
Dpm2
Name: dolichyl-phosphate mannosyltransferase subunit 2, regulatory
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13481
HGNC: HGNC:3006
Homologene: 99726
Rnase4
Name: ribonuclease, RNase A family 4
Synonyms: C730049F20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 58809
VEGA: 14
Homologene: 10576
Zbtb42
Name: zinc finger and BTB domain containing 42
Synonyms: simiRP58, Gm5188
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 382639
Homologene: 20003
Or1l4b
Name: olfactory receptor family 1 subfamily L member 4B
Synonyms: GA_x6K02T2NLDC-33831282-33832243, MOR138-4P, MOR138-7, Olfr364
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227794
Cyp2a12
Name: cytochrome P450, family 2, subfamily a, polypeptide 12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13085
Homologene: 69128
Fbxo25
Name: F-box protein 25
Synonyms: Fbx25, 9130015I06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66822
Homologene: 41649
Rps6kb2
Name: ribosomal protein S6 kinase, polypeptide 2
Synonyms: S6K2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58988
Homologene: 68374
Upp2
Name: uridine phosphorylase 2
Synonyms: UDRPASE2, UPASE2, UP2, 1700124F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76654
Homologene: 12654
Ltc4s
Name: leukotriene C4 synthase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17001
HGNC: HGNC:6719
Homologene: 7406
Ssr1
Name: signal sequence receptor, alpha
Synonyms: SSR, TRAPalpha
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107513
VEGA: 13
Homologene: 2368
Wdr74
Name: WD repeat domain 74
Synonyms: 5730436H21Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107071
Homologene: 41226
Catsper2
Name: cation channel, sperm associated 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 212670
Homologene: 77423
Duoxa2
Name: dual oxidase maturation factor 2
Synonyms: 9030623N16Rik, Nip2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66811
Homologene: 57037
H1f9
Name: H1.9 linker histone
Synonyms: TISP64, Hils1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54388
Homologene: 56818
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 20,955,368 bp
  • A to G, chromosome 1 at 75,530,174 bp
  • A to T, chromosome 2 at 25,039,697 bp
  • T to C, chromosome 2 at 32,572,379 bp
  • T to A, chromosome 2 at 37,146,414 bp
  • T to A, chromosome 2 at 58,790,165 bp
  • A to G, chromosome 2 at 66,351,014 bp
  • TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT to TAGGATGGCTTTTCTCAGGATAGCTTTTCTCAGGATGGCTTTTCTCAGGATAGCTTTTCT, chromosome 2 at 121,397,572 bp
  • G to A, chromosome 2 at 122,007,817 bp
  • A to G, chromosome 2 at 122,301,340 bp
  • A to G, chromosome 2 at 164,290,142 bp
  • A to C, chromosome 3 at 14,887,908 bp
  • A to C, chromosome 3 at 57,833,576 bp
  • T to C, chromosome 4 at 15,266,718 bp
  • C to T, chromosome 4 at 108,169,879 bp
  • T to A, chromosome 4 at 123,484,151 bp
  • T to A, chromosome 4 at 133,260,864 bp
  • T to C, chromosome 5 at 64,925,855 bp
  • T to C, chromosome 5 at 67,774,816 bp
  • T to A, chromosome 5 at 105,218,503 bp
  • A to T, chromosome 5 at 130,211,951 bp
  • T to C, chromosome 5 at 135,231,684 bp
  • G to T, chromosome 5 at 135,716,064 bp
  • A to T, chromosome 5 at 139,758,192 bp
  • A to G, chromosome 7 at 13,337,767 bp
  • T to A, chromosome 7 at 16,090,404 bp
  • T to C, chromosome 7 at 27,036,519 bp
  • A to T, chromosome 7 at 106,805,919 bp
  • T to C, chromosome 7 at 137,199,265 bp
  • C to A, chromosome 7 at 141,259,499 bp
  • C to A, chromosome 8 at 13,939,621 bp
  • T to C, chromosome 8 at 23,099,620 bp
  • T to A, chromosome 8 at 106,015,941 bp
  • C to T, chromosome 9 at 43,111,369 bp
  • A to T, chromosome 10 at 3,973,412 bp
  • G to T, chromosome 10 at 41,285,403 bp
  • T to C, chromosome 10 at 81,240,195 bp
  • C to T, chromosome 10 at 82,288,743 bp
  • G to A, chromosome 10 at 116,939,405 bp
  • C to A, chromosome 11 at 23,665,760 bp
  • T to C, chromosome 11 at 50,237,247 bp
  • T to A, chromosome 11 at 58,702,129 bp
  • A to T, chromosome 11 at 94,968,257 bp
  • A to T, chromosome 11 at 109,675,928 bp
  • T to C, chromosome 11 at 110,102,053 bp
  • A to G, chromosome 12 at 83,774,859 bp
  • G to A, chromosome 12 at 85,917,742 bp
  • A to T, chromosome 12 at 86,024,333 bp
  • T to A, chromosome 12 at 102,492,217 bp
  • G to A, chromosome 12 at 112,679,414 bp
  • A to G, chromosome 13 at 6,577,481 bp
  • A to G, chromosome 13 at 37,983,473 bp
  • T to A, chromosome 13 at 38,022,922 bp
  • T to A, chromosome 13 at 64,781,759 bp
  • T to A, chromosome 14 at 33,932,264 bp
  • A to G, chromosome 14 at 51,104,972 bp
  • A to G, chromosome 15 at 4,953,272 bp
  • A to G, chromosome 15 at 8,148,346 bp
  • A to G, chromosome 15 at 91,755,848 bp
  • C to A, chromosome 16 at 32,757,468 bp
  • A to G, chromosome 16 at 48,961,130 bp
  • T to A, chromosome 16 at 91,670,530 bp
  • A to G, chromosome 17 at 90,162,364 bp
  • T to C, chromosome 18 at 11,742,679 bp
  • T to C, chromosome 18 at 46,932,594 bp
  • T to C, chromosome 19 at 4,152,526 bp
  • A to T, chromosome 19 at 4,159,271 bp
  • G to A, chromosome 19 at 6,490,078 bp
  • C to A, chromosome 19 at 8,735,994 bp
  • A to T, chromosome 19 at 33,557,129 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9086 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068905-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.