Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9096Btlr/Mmmh
Stock Number:
068911-MU
Citation ID:
RRID:MMRRC_068911-MU
Other Names:
R9096 (G1)
Major Collection:

Strain Information

Dlc1
Name: deleted in liver cancer 1
Synonyms: p122-RhoGAP, STARD12, Arhgap7, A730069N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Prkca
Name: protein kinase C, alpha
Synonyms: Pkca
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18750
HGNC: HGNC:9393
Homologene: 55679
Rrp12
Name: ribosomal RNA processing 12 homolog
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107094
VEGA: 19
Homologene: 22370
Eprs1
Name: glutamyl-prolyl-tRNA synthetase 1
Synonyms: 3010002K18Rik, 2410081F06Rik, Qprs, Eprs
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 107508
HGNC: HGNC:3418
Homologene: 5870
Tasp1
Name: taspase, threonine aspartase 1
Synonyms: 4930485D02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75812
Homologene: 9795
Pkn2
Name: protein kinase N2
Synonyms: PRK2, 6030436C20Rik, Stk7, Prkcl2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109333
HGNC: HGNC:9406
Homologene: 2054
Gng2
Name: guanine nucleotide binding protein (G protein), gamma 2
Synonyms: 1110003P13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14702
HGNC: HGNC:4404
Homologene: 40715
Nol10
Name: nucleolar protein 10
Synonyms: LOC217431
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217431
VEGA: 12
Homologene: 5998
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Ubap1
Name: ubiquitin-associated protein 1
Synonyms: 2700092A01Rik, NAG20
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67123
Homologene: 9554
Usp24
Name: ubiquitin specific peptidase 24
Synonyms: 2810030C21Rik, 2700066K03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329908
Homologene: 35420
Rars1
Name: arginyl-tRNA synthetase 1
Synonyms: 2610037E21Rik, 2610011N19Rik, Rars
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104458
HGNC: HGNC:9870
Homologene: 68281
Iws1
Name: IWS1, SUPT6 interacting protein
Synonyms: 1700069O15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 73473
Homologene: 134421
Lepr
Name: leptin receptor
Synonyms: Obr, leptin receptor gene-related protein, OB-RGRP, LEPROT, obl, obese-like, Modb1, Leprb
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16847
HGNC: HGNC:6554
Homologene: 1731
Pld3
Name: phospholipase D family member 3
Synonyms: Sam-9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18807
Homologene: 7893
Lrrk2
Name: leucine-rich repeat kinase 2
Synonyms: cI-46, LOC381026, 9330188B09Rik, D630001M17Rik, 4921513O20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66725
Homologene: 18982
Armt1
Name: acidic residue methyltransferase 1
Synonyms: 1700052N19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73419
Homologene: 41557
Magel2
Name: MAGE family member L2
Synonyms: NDNL1, Mage-l2, nM15, ns7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27385
HGNC: HGNC:6814
Homologene: 8460
Arnt
Name: aryl hydrocarbon receptor nuclear translocator
Synonyms: Hif1b, ESTM42, D3Ertd557e, bHLHe2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11863
HGNC: HGNC:700
Homologene: 1261
2900026A02Rik
Name: RIKEN cDNA 2900026A02 gene
Synonyms: LOC231620, Gm449
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243219
Homologene: 129566
Zfp266
Name: zinc finger protein 266
Synonyms: 5330440G10Rik, 5730601F06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77519
Homologene: 105676
Kctd10
Name: potassium channel tetramerisation domain containing 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330171
Homologene: 32652
Dennd1a
Name: DENN domain containing 1A
Synonyms: 6030446I19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227801
Homologene: 17141
Tmem131l
Name: transmembrane 131 like
Synonyms: D930015E06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229473
Homologene: 9057
Pigt
Name: phosphatidylinositol glycan anchor biosynthesis, class T
Synonyms: CGI-06, 4930534E15Rik, Ndap7, NDAP, 2510012P17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78928
Homologene: 6134
Dnah1
Name: dynein, axonemal, heavy chain 1
Synonyms: MDHC7, E030034C22Rik, B230373P09Rik, Dnahc1, G1-415-19, ferf1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110084
VEGA: 14
HGNC: HGNC:2940
Homologene: 67131
Sycp2l
Name: synaptonemal complex protein 2-like
Synonyms: LOC218175, EG621792, Gm40956
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 637277
Homologene: 52882
Bmper
Name: BMP-binding endothelial regulator
Synonyms: Cv2, 3110056H04Rik, CV-2, Crim3, crossveinless-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73230
VEGA: 9
Homologene: 12494
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Depdc1a
Name: DEP domain containing 1a
Synonyms: 5830484J08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76131
Homologene: 9834
Tnr
Name: tenascin R
Synonyms: janusin, restrictin, TN-R, J1-tenascin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21960
Homologene: 124416
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Vmn1r50
Name: vomeronasal 1 receptor 50
Synonyms: VN2, V1rb1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 113852
Homologene: 113975
Ppp2r1b
Name: protein phosphatase 2, regulatory subunit A, beta
Synonyms: 2410091N08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73699
HGNC: HGNC:9303
Homologene: 70244
Col9a1
Name: collagen, type IX, alpha 1
Synonyms: Col9a-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12839
HGNC: HGNC:2217
Homologene: 1393
Or4f7
Name: olfactory receptor family 4 subfamily F member 7
Synonyms: GA_x6K02T2N82Q-3465-3764, GA_x6K02T2Q125-72882187-72881249, MOR245-28_p, MOR245-7, MOR245-7, Olfr276, Olfr1303
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258397
Homologene: 88429
Abhd12b
Name: abhydrolase domain containing 12B
Synonyms: LOC328121
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100504285
Homologene: 128243
Tmem260
Name: transmembrane protein 260
Synonyms: 6720456H20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218989
Homologene: 49506
Arhgap40
Name: Rho GTPase activating protein 40
Synonyms: Gm14203
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545481
Homologene: 53500
Mrc2
Name: mannose receptor, C type 2
Synonyms: novel lectin, Endo180, uPARAP
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17534
Homologene: 4408
Vmn1r181
Name: vomeronasal 1 receptor 181
Synonyms: V1rd20
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404289
Homologene: 104166
Ptpru
Name: protein tyrosine phosphatase receptor type U
Synonyms: Ptprl, RPTPlambda
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19273
HGNC: HGNC:9683
Homologene: 4168
Lpgat1
Name: lysophosphatidylglycerol acyltransferase 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226856
Homologene: 8914
Catsperg1
Name: cation channel sperm associated auxiliary subunit gamma 1
Synonyms: A230107C01Rik, Catsperg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320225
Homologene: 10915
Dzank1
Name: double zinc ribbon and ankyrin repeat domains 1
Synonyms: 2810039F03Rik, Ankrd64, 6330439K17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241688
Homologene: 10037
Gimd1
Name: GIMAP family P-loop NTPase domain containing 1
Synonyms: Gm5549
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433653
Homologene: 47516
Pcdhb21
Name: protocadherin beta 21
Synonyms: Pcdhb18, PcdhbU
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93892
Homologene: 134302
Hacd4
Name: 3-hydroxyacyl-CoA dehydratase 4
Synonyms: 4933428I03Rik, Ptplad2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66775
Homologene: 12033
Telo2
Name: telomere maintenance 2
Synonyms: 1200003M09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71718
Homologene: 41107
Vmn1r16
Name: vomeronasal 1 receptor 16
Synonyms: V1rc29
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171202
Homologene: 123821
Gab3
Name: growth factor receptor bound protein 2-associated protein 3
Synonyms: 5930433H21Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 210710
Homologene: 15417
Gpr162
Name: G protein-coupled receptor 162
Synonyms: A-2, Grca
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14788
Homologene: 8400
Sdc1
Name: syndecan 1
Synonyms: CD138, Synd, Synd1, syn-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20969
Homologene: 2252
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 24,185,126 bp
  • C to T, chromosome 1 at 150,657,118 bp
  • T to A, chromosome 1 at 159,850,234 bp
  • C to A, chromosome 1 at 185,407,106 bp
  • C to T, chromosome 1 at 188,466,136 bp
  • T to C, chromosome 1 at 191,719,457 bp
  • T to A, chromosome 2 at 29,893,496 bp
  • G to T, chromosome 2 at 37,800,065 bp
  • A to G, chromosome 2 at 76,742,069 bp
  • T to A, chromosome 2 at 111,813,851 bp
  • A to T, chromosome 2 at 139,883,770 bp
  • G to T, chromosome 2 at 144,474,962 bp
  • A to T, chromosome 2 at 158,547,664 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • A to T, chromosome 3 at 83,942,815 bp
  • G to T, chromosome 3 at 95,490,277 bp
  • T to A, chromosome 3 at 132,634,900 bp
  • C to T, chromosome 3 at 142,809,488 bp
  • T to A, chromosome 3 at 159,498,480 bp
  • T to C, chromosome 4 at 41,379,872 bp
  • A to G, chromosome 4 at 88,437,458 bp
  • T to C, chromosome 4 at 101,774,221 bp
  • T to G, chromosome 4 at 106,397,311 bp
  • T to C, chromosome 4 at 131,772,532 bp
  • T to C, chromosome 5 at 73,108,577 bp
  • A to T, chromosome 5 at 113,191,927 bp
  • C to T, chromosome 5 at 114,370,171 bp
  • T to A, chromosome 5 at 115,548,621 bp
  • A to G, chromosome 6 at 4,906,012 bp
  • A to T, chromosome 6 at 57,323,265 bp
  • G to A, chromosome 6 at 90,108,040 bp
  • A to G, chromosome 6 at 124,859,607 bp
  • A to G, chromosome 7 at 23,985,019 bp
  • A to G, chromosome 7 at 27,532,664 bp
  • G to C, chromosome 7 at 29,184,727 bp
  • A to G, chromosome 7 at 62,380,549 bp
  • GCG to GCGACGGCGCCG, chromosome 7 at 97,579,907 bp
  • A to T, chromosome 8 at 36,613,567 bp
  • A to T, chromosome 9 at 20,505,144 bp
  • T to C, chromosome 9 at 23,223,692 bp
  • A to G, chromosome 9 at 50,866,556 bp
  • T to C, chromosome 10 at 4,434,829 bp
  • T to C, chromosome 10 at 88,775,318 bp
  • A to G, chromosome 11 at 21,277,913 bp
  • T to C, chromosome 11 at 35,827,429 bp
  • A to G, chromosome 11 at 105,340,572 bp
  • A to G, chromosome 11 at 108,014,235 bp
  • T to C, chromosome 12 at 8,791,665 bp
  • T to A, chromosome 12 at 17,416,198 bp
  • T to A, chromosome 12 at 70,163,433 bp
  • A to T, chromosome 13 at 41,146,594 bp
  • T to C, chromosome 14 at 6,873,057 bp
  • T to A, chromosome 14 at 19,891,403 bp
  • T to A, chromosome 14 at 31,261,070 bp
  • T to A, chromosome 14 at 48,520,346 bp
  • C to T, chromosome 15 at 91,673,256 bp
  • T to C, chromosome 17 at 25,105,092 bp
  • T to C, chromosome 18 at 32,083,320 bp
  • A to G, chromosome 18 at 37,515,018 bp
  • A to T, chromosome 19 at 41,890,138 bp
  • TTC to TTCCTC, chromosome X at 75,000,004 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9096 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068911-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.