Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9096Btlr/Mmmh
Stock Number:
068911-MU
Citation ID:
RRID:MMRRC_068911-MU
Other Names:
R9096 (G1)
Major Collection:

Strain Information

Dlc1
Name: deleted in liver cancer 1
Synonyms: p122-RhoGAP, STARD12, Arhgap7, A730069N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Prkca
Name: protein kinase C, alpha
Synonyms: Pkca
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18750
HGNC: HGNC:9393
Homologene: 55679
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 24,185,126 bp
  • C to T, chromosome 1 at 150,657,118 bp
  • T to A, chromosome 1 at 159,850,234 bp
  • C to A, chromosome 1 at 185,407,106 bp
  • C to T, chromosome 1 at 188,466,136 bp
  • T to C, chromosome 1 at 191,719,457 bp
  • T to A, chromosome 2 at 29,893,496 bp
  • G to T, chromosome 2 at 37,800,065 bp
  • A to G, chromosome 2 at 76,742,069 bp
  • T to A, chromosome 2 at 111,813,851 bp
  • A to T, chromosome 2 at 139,883,770 bp
  • G to T, chromosome 2 at 144,474,962 bp
  • A to T, chromosome 2 at 158,547,664 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • A to T, chromosome 3 at 83,942,815 bp
  • G to T, chromosome 3 at 95,490,277 bp
  • T to A, chromosome 3 at 132,634,900 bp
  • C to T, chromosome 3 at 142,809,488 bp
  • T to A, chromosome 3 at 159,498,480 bp
  • T to C, chromosome 4 at 41,379,872 bp
  • A to G, chromosome 4 at 88,437,458 bp
  • T to C, chromosome 4 at 101,774,221 bp
  • T to G, chromosome 4 at 106,397,311 bp
  • T to C, chromosome 4 at 131,772,532 bp
  • T to C, chromosome 5 at 73,108,577 bp
  • A to T, chromosome 5 at 113,191,927 bp
  • C to T, chromosome 5 at 114,370,171 bp
  • T to A, chromosome 5 at 115,548,621 bp
  • A to G, chromosome 6 at 4,906,012 bp
  • A to T, chromosome 6 at 57,323,265 bp
  • G to A, chromosome 6 at 90,108,040 bp
  • A to G, chromosome 6 at 124,859,607 bp
  • A to G, chromosome 7 at 23,985,019 bp
  • A to G, chromosome 7 at 27,532,664 bp
  • G to C, chromosome 7 at 29,184,727 bp
  • A to G, chromosome 7 at 62,380,549 bp
  • GCG to GCGACGGCGCCG, chromosome 7 at 97,579,907 bp
  • A to T, chromosome 8 at 36,613,567 bp
  • A to T, chromosome 9 at 20,505,144 bp
  • T to C, chromosome 9 at 23,223,692 bp
  • A to G, chromosome 9 at 50,866,556 bp
  • T to C, chromosome 10 at 4,434,829 bp
  • T to C, chromosome 10 at 88,775,318 bp
  • A to G, chromosome 11 at 21,277,913 bp
  • T to C, chromosome 11 at 35,827,429 bp
  • A to G, chromosome 11 at 105,340,572 bp
  • A to G, chromosome 11 at 108,014,235 bp
  • T to C, chromosome 12 at 8,791,665 bp
  • T to A, chromosome 12 at 17,416,198 bp
  • T to A, chromosome 12 at 70,163,433 bp
  • A to T, chromosome 13 at 41,146,594 bp
  • T to C, chromosome 14 at 6,873,057 bp
  • T to A, chromosome 14 at 19,891,403 bp
  • T to A, chromosome 14 at 31,261,070 bp
  • T to A, chromosome 14 at 48,520,346 bp
  • C to T, chromosome 15 at 91,673,256 bp
  • T to C, chromosome 17 at 25,105,092 bp
  • T to C, chromosome 18 at 32,083,320 bp
  • A to G, chromosome 18 at 37,515,018 bp
  • A to T, chromosome 19 at 41,890,138 bp
  • TTC to TTCCTC, chromosome X at 75,000,004 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9096 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068911-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.