Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9100Btlr/Mmmh
Stock Number:
068914-MU
Citation ID:
RRID:MMRRC_068914-MU
Other Names:
R9100 (G1)
Major Collection:

Strain Information

Sema3e
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E
Synonyms: Semah
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20349
Homologene: 8247
Gldc
Name: glycine decarboxylase
Synonyms: D19Wsu57e, D030049L12Rik, b2b2679Clo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104174
VEGA: 19
HGNC: HGNC:4313
Homologene: 141
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Cyp11b2
Name: cytochrome P450, family 11, subfamily b, polypeptide 2
Synonyms: aldosterone synthase, Cyp11b-2, Cyp11b, steroid-11-beta-hydroxylase
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 13072
Homologene: 128035
Gck
Name: glucokinase
Synonyms: hexokinase 4, MODY2, HK4, Gls006, Hlb62
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103988
HGNC: HGNC:4195
Homologene: 55440
Uba3
Name: ubiquitin-like modifier activating enzyme 3
Synonyms: ubiquitin activating enzyme 3, A830034N06Rik, Ube1c
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22200
Homologene: 2951
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 12,807,894 bp
  • A to T, chromosome 1 at 91,423,742 bp
  • A to G, chromosome 1 at 151,423,505 bp
  • T to C, chromosome 2 at 23,399,768 bp
  • T to G, chromosome 2 at 62,374,389 bp
  • A to G, chromosome 2 at 85,975,752 bp
  • T to C, chromosome 2 at 88,024,986 bp
  • A to G, chromosome 2 at 111,269,749 bp
  • A to G, chromosome 2 at 111,873,261 bp
  • T to C, chromosome 2 at 119,068,988 bp
  • T to G, chromosome 2 at 119,211,237 bp
  • A to G, chromosome 3 at 32,460,019 bp
  • A to G, chromosome 3 at 37,044,758 bp
  • A to C, chromosome 3 at 39,010,654 bp
  • A to G, chromosome 4 at 66,840,281 bp
  • T to C, chromosome 4 at 124,936,445 bp
  • T to G, chromosome 4 at 143,699,157 bp
  • T to A, chromosome 4 at 143,897,076 bp
  • T to C, chromosome 5 at 8,449,613 bp
  • A to G, chromosome 5 at 14,232,194 bp
  • T to C, chromosome 5 at 30,382,352 bp
  • G to T, chromosome 5 at 31,498,396 bp
  • T to A, chromosome 5 at 34,613,278 bp
  • A to C, chromosome 5 at 81,694,452 bp
  • T to C, chromosome 5 at 96,083,016 bp
  • C to T, chromosome 5 at 110,189,678 bp
  • G to C, chromosome 5 at 113,613,982 bp
  • G to A, chromosome 5 at 138,256,333 bp
  • T to G, chromosome 6 at 72,370,321 bp
  • A to T, chromosome 6 at 97,186,710 bp
  • A to T, chromosome 6 at 116,541,029 bp
  • A to G, chromosome 7 at 3,658,193 bp
  • T to A, chromosome 7 at 10,580,137 bp
  • G to A, chromosome 7 at 35,795,021 bp
  • C to T, chromosome 7 at 47,334,984 bp
  • A to G, chromosome 7 at 80,238,534 bp
  • G to A, chromosome 7 at 87,376,240 bp
  • G to C, chromosome 7 at 96,845,854 bp
  • T to A, chromosome 7 at 98,194,751 bp
  • C to T, chromosome 7 at 118,695,082 bp
  • GCCACAGCCTCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACCACAGCCCCCACAGGAACTACA to GCCACAGCCCCCACAGGAACTACA, chromosome 7 at 142,175,099 bp
  • AGGCGGCGGCGGCGG to AGGCGGCGGCGG, chromosome 8 at 36,248,765 bp
  • A to G, chromosome 8 at 69,088,824 bp
  • A to G, chromosome 8 at 95,036,263 bp
  • C to A, chromosome 8 at 104,831,589 bp
  • A to T, chromosome 8 at 105,949,142 bp
  • T to A, chromosome 9 at 18,645,670 bp
  • C to A, chromosome 9 at 35,565,650 bp
  • T to C, chromosome 9 at 100,495,508 bp
  • A to T, chromosome 10 at 52,429,191 bp
  • T to C, chromosome 10 at 60,768,373 bp
  • T to C, chromosome 10 at 81,309,222 bp
  • T to A, chromosome 10 at 88,133,107 bp
  • A to G, chromosome 11 at 5,906,516 bp
  • A to G, chromosome 11 at 55,262,521 bp
  • A to G, chromosome 11 at 73,787,861 bp
  • A to T, chromosome 11 at 90,535,494 bp
  • T to C, chromosome 11 at 103,200,067 bp
  • T to A, chromosome 11 at 121,069,743 bp
  • A to T, chromosome 12 at 8,298,652 bp
  • T to C, chromosome 12 at 36,186,807 bp
  • A to G, chromosome 14 at 33,530,450 bp
  • G to A, chromosome 14 at 96,346,928 bp
  • A to G, chromosome 14 at 118,616,388 bp
  • T to C, chromosome 15 at 74,851,146 bp
  • A to T, chromosome 15 at 81,922,516 bp
  • G to C, chromosome 15 at 98,849,951 bp
  • A to G, chromosome 16 at 11,828,555 bp
  • A to T, chromosome 16 at 18,437,565 bp
  • T to A, chromosome 16 at 33,920,181 bp
  • T to A, chromosome 16 at 36,187,915 bp
  • T to A, chromosome 16 at 58,486,430 bp
  • T to C, chromosome 17 at 43,625,414 bp
  • G to A, chromosome 17 at 71,810,889 bp
  • C to T, chromosome 17 at 75,315,107 bp
  • T to A, chromosome 17 at 75,315,108 bp
  • T to C, chromosome 19 at 6,855,845 bp
  • G to T, chromosome 19 at 12,098,890 bp
  • A to G, chromosome 19 at 30,099,914 bp
  • C to G, chromosome 19 at 41,324,485 bp
  • C to T, chromosome X at 23,247,494 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9100 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068914-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.