Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9133Btlr/Mmmh
Stock Number:
068930-MU
Citation ID:
RRID:MMRRC_068930-MU
Other Names:
R9133 (G1)
Major Collection:

Strain Information

Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Gjd2
Name: gap junction protein, delta 2
Synonyms: connexin36, Cx36, Gja9
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14617
Homologene: 7734
Ncoa3
Name: nuclear receptor coactivator 3
Synonyms: pCIP, TRAM-1, AIB1, RAC3, TRAM1, Src3, 2010305B15Rik, KAT13B, bHLHe42
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17979
HGNC: HGNC:7670
Homologene: 4764
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Ehmt1
Name: euchromatic histone methyltransferase 1
Synonyms: 9230102N17Rik, KMT1D
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77683
Homologene: 11698
Top1
Name: topoisomerase (DNA) I
Synonyms: Top-1, D130064I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21969
Homologene: 2467
Nphs1
Name: nephrosis 1, nephrin
Synonyms: nephrin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54631
HGNC: HGNC:7908
Homologene: 20974
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 55,237,562 bp
  • A to T, chromosome 1 at 88,275,050 bp
  • C to A, chromosome 1 at 106,030,805 bp
  • A to T, chromosome 1 at 129,915,645 bp
  • A to T, chromosome 1 at 134,602,585 bp
  • C to T, chromosome 1 at 139,491,528 bp
  • A to T, chromosome 2 at 24,839,623 bp
  • T to C, chromosome 2 at 32,744,766 bp
  • T to C, chromosome 2 at 52,193,244 bp
  • T to C, chromosome 2 at 88,050,438 bp
  • T to C, chromosome 2 at 114,011,558 bp
  • G to C, chromosome 2 at 153,804,941 bp
  • C to T, chromosome 2 at 160,703,671 bp
  • A to G, chromosome 2 at 166,068,461 bp
  • T to C, chromosome 4 at 58,957,722 bp
  • T to C, chromosome 5 at 31,285,523 bp
  • A to G, chromosome 5 at 117,703,254 bp
  • A to G, chromosome 5 at 124,782,359 bp
  • T to C, chromosome 5 at 147,315,441 bp
  • A to T, chromosome 6 at 8,659,921 bp
  • A to G, chromosome 6 at 24,734,586 bp
  • G to T, chromosome 6 at 48,457,813 bp
  • A to G, chromosome 6 at 65,072,051 bp
  • G to T, chromosome 6 at 68,755,264 bp
  • A to C, chromosome 6 at 72,380,379 bp
  • A to T, chromosome 6 at 83,226,235 bp
  • G to A, chromosome 6 at 94,534,162 bp
  • C to T, chromosome 6 at 107,567,607 bp
  • A to G, chromosome 6 at 140,633,715 bp
  • A to G, chromosome 7 at 5,676,063 bp
  • GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC to GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC, chromosome 7 at 6,709,168 bp
  • G to T, chromosome 7 at 30,460,667 bp
  • A to G, chromosome 7 at 41,650,060 bp
  • C to T, chromosome 7 at 81,332,871 bp
  • T to G, chromosome 7 at 119,845,444 bp
  • G to T, chromosome 8 at 47,851,972 bp
  • A to G, chromosome 8 at 69,663,133 bp
  • A to G, chromosome 8 at 84,549,523 bp
  • T to C, chromosome 8 at 105,885,146 bp
  • T to A, chromosome 9 at 39,623,513 bp
  • T to A, chromosome 9 at 39,669,678 bp
  • A to G, chromosome 9 at 89,911,547 bp
  • T to A, chromosome 9 at 111,391,702 bp
  • A to G, chromosome 10 at 50,754,079 bp
  • T to C, chromosome 10 at 58,477,228 bp
  • T to A, chromosome 10 at 125,230,667 bp
  • T to C, chromosome 11 at 119,341,009 bp
  • G to T, chromosome 12 at 46,818,741 bp
  • C to G, chromosome 12 at 83,951,447 bp
  • T to A, chromosome 12 at 114,300,263 bp
  • T to A, chromosome 13 at 65,185,069 bp
  • A to G, chromosome 13 at 75,872,393 bp
  • A to G, chromosome 13 at 93,097,600 bp
  • A to G, chromosome 14 at 7,791,936 bp
  • A to T, chromosome 14 at 68,577,098 bp
  • A to G, chromosome 15 at 76,576,412 bp
  • G to A, chromosome 17 at 5,753,008 bp
  • T to A, chromosome 17 at 12,940,289 bp
  • T to A, chromosome 17 at 23,552,029 bp
  • G to T, chromosome 17 at 26,095,415 bp
  • T to A, chromosome 17 at 34,094,531 bp
  • C to A, chromosome 17 at 34,804,445 bp
  • T to C, chromosome 17 at 56,696,791 bp
  • C to T, chromosome 18 at 20,101,847 bp
  • C to A, chromosome 18 at 40,259,016 bp
  • A to G, chromosome 19 at 11,303,674 bp
  • A to T, chromosome 19 at 43,767,288 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9133 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068930-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.