Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9133Btlr/Mmmh
Stock Number:
068930-MU
Citation ID:
RRID:MMRRC_068930-MU
Other Names:
R9133 (G1)
Major Collection:

Strain Information

Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Gjd2
Name: gap junction protein, delta 2
Synonyms: connexin36, Cx36, Gja9
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14617
Homologene: 7734
Ncoa3
Name: nuclear receptor coactivator 3
Synonyms: pCIP, TRAM-1, AIB1, RAC3, TRAM1, Src3, 2010305B15Rik, KAT13B, bHLHe42
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17979
HGNC: HGNC:7670
Homologene: 4764
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Ehmt1
Name: euchromatic histone methyltransferase 1
Synonyms: 9230102N17Rik, KMT1D
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77683
Homologene: 11698
Top1
Name: topoisomerase (DNA) I
Synonyms: Top-1, D130064I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21969
Homologene: 2467
Nphs1
Name: nephrosis 1, nephrin
Synonyms: nephrin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54631
HGNC: HGNC:7908
Homologene: 20974
Smarcad1
Name: SNF2 related chromatin remodeling ATPase with DExD box 1
Synonyms: D6Pas1, Etl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13990
Homologene: 5301
Slc25a26
Name: solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 26
Synonyms: 4930433D19Rik, 4933433F13Rik, D6Bwg0781e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67582
Homologene: 6834
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Ranbp2
Name: RAN binding protein 2
Synonyms: A430087B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19386
VEGA: 10
HGNC: HGNC:9848
Homologene: 87808
Ranbp3
Name: RAN binding protein 3
Synonyms: 2610024N24Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71810
VEGA: 17
HGNC: HGNC:9850
Homologene: 136516
Nova1
Name: NOVA alternative splicing regulator 1
Synonyms: Nova-1, 9430099M15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 664883
VEGA: 12
HGNC: HGNC:7886
Homologene: 21296
Wwc2
Name: WW, C2 and coiled-coil domain containing 2
Synonyms: D8Ertd594e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52357
Homologene: 32618
Peg3
Name: paternally expressed 3
Synonyms: Pw1, Zfp102, End4, Gcap4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18616
HGNC: HGNC:8826
Homologene: 31363
Hjurp
Name: Holliday junction recognition protein
Synonyms: C330011F01Rik, A730008H23Rik, 6430706D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381280
Homologene: 10184
Ms4a14
Name: membrane-spanning 4-domains, subfamily A, member 14
Synonyms: LOC383435
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 383435
Homologene: 138453
Zcchc2
Name: zinc finger, CCHC domain containing 2
Synonyms: 9930114B20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227449
Homologene: 9808
Edc4
Name: enhancer of mRNA decapping 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234699
Homologene: 40937
Sh2d3c
Name: SH2 domain containing 3C
Synonyms: Shep1, SH2-containing Eph receptor-binding protein 1, Cas/HEF1-associated signal transducer, Chat, Nsp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27387
Homologene: 69145
Ift172
Name: intraflagellar transport 172
Synonyms: wim, 4930553F24Rik, avc1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67661
Homologene: 15202
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: Cacnl1a4, alpha1A, Ccha1a, SCA6, nmf352, smrl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Ksr2
Name: kinase suppressor of ras 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 333050
Homologene: 45469
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E16Rik, 2310076E21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Cutc
Name: cutC copper transporter
Synonyms: CGI-32, 2310039I18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66388
Homologene: 9318
Slc4a5
Name: solute carrier family 4, sodium bicarbonate cotransporter, member 5
Synonyms: C330016K18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232156
Homologene: 31125
Trank1
Name: tetratricopeptide repeat and ankyrin repeat containing 1
Synonyms: A230061D21Rik, LOC235639, C030048J01Rik, Lba1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320429
Homologene: 45845
Slc16a7
Name: solute carrier family 16 (monocarboxylic acid transporters), member 7
Synonyms: MCT2, 4921534N07Rik, D630004K10Rik, 9030411M13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20503
Homologene: 20990
Rhobtb3
Name: Rho-related BTB domain containing 3
Synonyms: 1700040C17Rik, 4930503C18Rik, 2610033K01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73296
Homologene: 8932
Pde8a
Name: phosphodiesterase 8A
Synonyms: Pde8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18584
HGNC: HGNC:8793
Homologene: 1957
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Ica1
Name: islet cell autoantigen 1
Synonyms: ICA69, 69kDa
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15893
HGNC: HGNC:5343
Homologene: 7777
Kctd16
Name: potassium channel tetramerisation domain containing 16
Synonyms: 4930434H12Rik, LOC383347, 2900055J20Rik, C030017B01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 383348
VEGA: 18
Homologene: 44779
Urad
Name: ureidoimidazoline (2-oxo-4-hydroxy-4-carboxy-5) decarboxylase
Synonyms: EG231903, Prhoxnb
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231903
Homologene: 82563
Nme4
Name: NME/NM23 nucleoside diphosphate kinase 4
Synonyms: NM23-M4, 5730493H09Rik, 2810024O08Rik, 2610027N22Rik, non-metastatic cells 4, protein expressed in
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56520
HGNC: HGNC:7852
Homologene: 3673
Card14
Name: caspase recruitment domain family, member 14
Synonyms: CARMA2, Bimp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 170720
Homologene: 11469
Thsd7b
Name: thrombospondin, type I, domain containing 7B
Synonyms: 1700074E13Rik, D130067I03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210417
Homologene: 18180
Zdhhc14
Name: zinc finger, DHHC domain containing 14
Synonyms: New1cp, B530001K09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224454
VEGA: 17
Homologene: 62301
Adamdec1
Name: ADAM-like, decysin 1
Synonyms: 2210414L24Rik, Dcsn
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 58860
VEGA: 14
Homologene: 8711
Zfp788
Name: zinc finger protein 788
Synonyms: 2810426N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67607
Homologene: 137363
Rasgrf1
Name: RAS protein-specific guanine nucleotide-releasing factor 1
Synonyms: CDC25Mm, CDC25, Grfbeta, Grf1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19417
HGNC: HGNC:9875
Homologene: 74972
Zkscan16
Name: zinc finger with KRAB and SCAN domains 16
Synonyms: Zfp483
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041581
Homologene: 26419
Or5d14
Name: olfactory receptor family 5 subfamily D member 14
Synonyms: GA_x6K02T2Q125-49542541-49541597, MOR174-14, Olfr1162
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258105
Homologene: 79476
Casp16
Name: caspase 16, apoptosis-related cysteine peptidase
Synonyms: Gm5146, Casp16, Casp16-ps
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381070
Homologene: 72522
Rexo5
Name: RNA exonuclease 5
Synonyms: 2610020H08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434234
Homologene: 12803
Nlrp4f
Name: NLR family, pyrin domain containing 4F
Synonyms: Nalp-kappa, C330026N02Rik, Nalp4f
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 97895
VEGA: 13
Homologene: 87252
Dsc1
Name: desmocollin 1
Synonyms: Dsc1b, Dsc1a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13505
VEGA: 18
HGNC: HGNC:3035
Homologene: 22761
Vmn1r62
Name: vomeronasal 1 receptor 62
Synonyms: V3R2, V1rd8, V1rd2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81016
Homologene: 41799
Cyp21a1
Name: cytochrome P450, family 21, subfamily a, polypeptide 1
Synonyms: 21-OH, 21-hydroxylase, 21OH, Oh21-1, 21OHA, Cyp21, Oh21-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13079
Homologene: 68063
Hyal6
Name: hyaluronoglucosaminidase 6
Synonyms: 4932701A20Rik, Hyal-ps1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74409
HGNC: HGNC:5324
Homologene: 78028
Zfp964
Name: zinc finger protein 964
Synonyms: Gm7187
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 636741
Homologene: 130114
Vamp5
Name: vesicle-associated membrane protein 5
Synonyms: Camp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 53620
Homologene: 4833
Adck5
Name: aarF domain containing kinase 5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268822
Homologene: 34378
Or10d4
Name: olfactory receptor family 10 subfamily D member 4
Synonyms: GA_x6K02T2PVTD-33365879-33366814, MOR224-7P, MOR224-13, Olfr963
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258087
VEGA: 9
Homologene: 105216
Acat3
Name: acetyl-Coenzyme A acetyltransferase 3
Synonyms: ACTL
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224530
HGNC: HGNC:94
Homologene: 55855
H2-Oa
Name: histocompatibility 2, O region alpha locus
Synonyms: H-2Oa
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15001
HGNC: HGNC:4936
Homologene: 1601
Efcab8
Name: EF-hand calcium binding domain 8
Synonyms: EG329541
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100504221
Riox1
Name: ribosomal oxygenase 1
Synonyms: NO66, 2410016O06Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71952
VEGA: 12
Homologene: 11366
Or10d4b
Name: olfactory receptor family 10 subfamily D member 4B
Synonyms: GA_x6K02T2PVTD-33320043-33320987, MOR224-12, Olfr960
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258276
VEGA: 9
Homologene: 17168
Ighv9-4
Name: immunoglobulin heavy variable 9-4
Synonyms: Gm7175
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 636260
Mars2
Name: methionine-tRNA synthetase 2 (mitochondrial)
Synonyms: C730026E21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 212679
Homologene: 6009
Igkv4-92
Name: immunoglobulin kappa variable 4-92
Synonyms: LOC384410, IgVk ay4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 384410
Gm26661
Name: predicted gene, 26661
Type: Gene
Species: Mouse
Chromosome: 14
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 55,237,562 bp
  • A to T, chromosome 1 at 88,275,050 bp
  • C to A, chromosome 1 at 106,030,805 bp
  • A to T, chromosome 1 at 129,915,645 bp
  • A to T, chromosome 1 at 134,602,585 bp
  • C to T, chromosome 1 at 139,491,528 bp
  • A to T, chromosome 2 at 24,839,623 bp
  • T to C, chromosome 2 at 32,744,766 bp
  • T to C, chromosome 2 at 52,193,244 bp
  • T to C, chromosome 2 at 88,050,438 bp
  • T to C, chromosome 2 at 114,011,558 bp
  • G to C, chromosome 2 at 153,804,941 bp
  • C to T, chromosome 2 at 160,703,671 bp
  • A to G, chromosome 2 at 166,068,461 bp
  • T to C, chromosome 4 at 58,957,722 bp
  • T to C, chromosome 5 at 31,285,523 bp
  • A to G, chromosome 5 at 117,703,254 bp
  • A to G, chromosome 5 at 124,782,359 bp
  • T to C, chromosome 5 at 147,315,441 bp
  • A to T, chromosome 6 at 8,659,921 bp
  • A to G, chromosome 6 at 24,734,586 bp
  • G to T, chromosome 6 at 48,457,813 bp
  • A to G, chromosome 6 at 65,072,051 bp
  • G to T, chromosome 6 at 68,755,264 bp
  • A to C, chromosome 6 at 72,380,379 bp
  • A to T, chromosome 6 at 83,226,235 bp
  • G to A, chromosome 6 at 94,534,162 bp
  • C to T, chromosome 6 at 107,567,607 bp
  • A to G, chromosome 6 at 140,633,715 bp
  • A to G, chromosome 7 at 5,676,063 bp
  • GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC to GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC, chromosome 7 at 6,709,168 bp
  • G to T, chromosome 7 at 30,460,667 bp
  • A to G, chromosome 7 at 41,650,060 bp
  • C to T, chromosome 7 at 81,332,871 bp
  • T to G, chromosome 7 at 119,845,444 bp
  • G to T, chromosome 8 at 47,851,972 bp
  • A to G, chromosome 8 at 69,663,133 bp
  • A to G, chromosome 8 at 84,549,523 bp
  • T to C, chromosome 8 at 105,885,146 bp
  • T to A, chromosome 9 at 39,623,513 bp
  • T to A, chromosome 9 at 39,669,678 bp
  • A to G, chromosome 9 at 89,911,547 bp
  • T to A, chromosome 9 at 111,391,702 bp
  • A to G, chromosome 10 at 50,754,079 bp
  • T to C, chromosome 10 at 58,477,228 bp
  • T to A, chromosome 10 at 125,230,667 bp
  • T to C, chromosome 11 at 119,341,009 bp
  • G to T, chromosome 12 at 46,818,741 bp
  • C to G, chromosome 12 at 83,951,447 bp
  • T to A, chromosome 12 at 114,300,263 bp
  • T to A, chromosome 13 at 65,185,069 bp
  • A to G, chromosome 13 at 75,872,393 bp
  • A to G, chromosome 13 at 93,097,600 bp
  • A to G, chromosome 14 at 7,791,936 bp
  • A to T, chromosome 14 at 68,577,098 bp
  • A to G, chromosome 15 at 76,576,412 bp
  • G to A, chromosome 17 at 5,753,008 bp
  • T to A, chromosome 17 at 12,940,289 bp
  • T to A, chromosome 17 at 23,552,029 bp
  • G to T, chromosome 17 at 26,095,415 bp
  • T to A, chromosome 17 at 34,094,531 bp
  • C to A, chromosome 17 at 34,804,445 bp
  • T to C, chromosome 17 at 56,696,791 bp
  • C to T, chromosome 18 at 20,101,847 bp
  • C to A, chromosome 18 at 40,259,016 bp
  • A to G, chromosome 19 at 11,303,674 bp
  • A to T, chromosome 19 at 43,767,288 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9133 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068930-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.