Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9147Btlr/Mmmh
Stock Number:
068936-MU
Citation ID:
RRID:MMRRC_068936-MU
Other Names:
R9147 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Zdhhc17
Name: zinc finger, DHHC domain containing 17
Synonyms: A230053P19Rik, D130071N24Rik, Hip14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320150
VEGA: 10
Homologene: 56324
Nos1
Name: nitric oxide synthase 1, neuronal
Synonyms: nNOS, bNOS, Nos-1, NO, 2310005C01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18125
HGNC: HGNC:7872
Homologene: 37327
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Rfx3
Name: regulatory factor X, 3 (influences HLA class II expression)
Synonyms: MRFX3, C230093O12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19726
HGNC: HGNC:9984
Homologene: 7917
Ptpa
Name: protein phosphatase 2 protein activator
Synonyms: 2610042B21Rik, Ppp2r4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110854
HGNC: HGNC:9308
Homologene: 6149
Hspa12a
Name: heat shock protein 12A
Synonyms: Hspa12a, 1700063D12Rik, Gm19925
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73442
VEGA: 19
Homologene: 18422
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,189,068 bp
  • G to T, chromosome 1 at 34,443,392 bp
  • A to T, chromosome 1 at 119,642,589 bp
  • A to G, chromosome 1 at 144,002,187 bp
  • A to G, chromosome 1 at 166,201,690 bp
  • G to A, chromosome 2 at 14,967,962 bp
  • T to A, chromosome 2 at 26,993,012 bp
  • T to A, chromosome 2 at 30,438,243 bp
  • G to T, chromosome 2 at 30,438,244 bp
  • A to G, chromosome 2 at 36,786,926 bp
  • T to C, chromosome 2 at 37,332,005 bp
  • T to C, chromosome 2 at 66,684,163 bp
  • A to G, chromosome 2 at 86,385,980 bp
  • G to A, chromosome 2 at 90,458,218 bp
  • A to G, chromosome 2 at 90,703,145 bp
  • A to C, chromosome 2 at 113,441,628 bp
  • A to T, chromosome 2 at 165,515,623 bp
  • T to A, chromosome 3 at 68,870,012 bp
  • C to T, chromosome 3 at 125,438,073 bp
  • T to C, chromosome 4 at 3,996,200 bp
  • A to T, chromosome 4 at 25,278,712 bp
  • A to T, chromosome 4 at 136,181,284 bp
  • A to G, chromosome 4 at 148,165,709 bp
  • A to G, chromosome 4 at 154,254,673 bp
  • A to T, chromosome 5 at 25,210,355 bp
  • G to C, chromosome 5 at 117,879,337 bp
  • T to C, chromosome 5 at 120,948,817 bp
  • C to A, chromosome 5 at 125,787,103 bp
  • T to A, chromosome 5 at 138,646,285 bp
  • T to C, chromosome 5 at 143,244,634 bp
  • A to T, chromosome 6 at 15,286,712 bp
  • A to G, chromosome 6 at 29,418,071 bp
  • C to A, chromosome 6 at 40,884,044 bp
  • A to G, chromosome 6 at 53,818,152 bp
  • TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG, chromosome 6 at 99,075,905 bp
  • A to G, chromosome 6 at 119,948,670 bp
  • T to C, chromosome 6 at 124,540,799 bp
  • A to G, chromosome 7 at 6,189,679 bp
  • C to T, chromosome 7 at 23,835,360 bp
  • A to T, chromosome 7 at 31,138,181 bp
  • G to A, chromosome 7 at 31,375,626 bp
  • C to T, chromosome 7 at 44,900,286 bp
  • T to G, chromosome 7 at 123,186,444 bp
  • A to G, chromosome 7 at 128,148,741 bp
  • C to T, chromosome 8 at 75,222,219 bp
  • T to C, chromosome 8 at 82,764,434 bp
  • T to C, chromosome 8 at 105,885,846 bp
  • A to T, chromosome 8 at 106,894,678 bp
  • A to T, chromosome 9 at 6,333,328 bp
  • T to A, chromosome 9 at 20,213,062 bp
  • A to G, chromosome 9 at 44,249,379 bp
  • T to A, chromosome 9 at 50,621,021 bp
  • A to T, chromosome 9 at 56,136,676 bp
  • A to T, chromosome 10 at 36,832,921 bp
  • A to G, chromosome 10 at 52,050,943 bp
  • A to T, chromosome 10 at 79,067,572 bp
  • A to T, chromosome 10 at 79,194,853 bp
  • A to T, chromosome 10 at 110,949,642 bp
  • G to T, chromosome 11 at 4,186,835 bp
  • A to T, chromosome 11 at 62,333,846 bp
  • A to C, chromosome 11 at 74,289,343 bp
  • A to T, chromosome 11 at 75,432,592 bp
  • A to G, chromosome 11 at 78,504,396 bp
  • C to T, chromosome 11 at 113,823,400 bp
  • T to G, chromosome 11 at 116,334,410 bp
  • A to C, chromosome 12 at 73,108,907 bp
  • A to G, chromosome 12 at 75,890,384 bp
  • T to C, chromosome 12 at 111,833,834 bp
  • A to T, chromosome 12 at 113,948,380 bp
  • T to C, chromosome 12 at 119,450,356 bp
  • C to A, chromosome 13 at 9,136,783 bp
  • T to C, chromosome 13 at 61,001,435 bp
  • T to C, chromosome 13 at 91,694,022 bp
  • C to T, chromosome 13 at 112,533,742 bp
  • T to C, chromosome 14 at 31,482,898 bp
  • T to C, chromosome 14 at 56,259,507 bp
  • T to C, chromosome 14 at 61,212,688 bp
  • T to A, chromosome 15 at 73,557,614 bp
  • T to C, chromosome 15 at 87,544,574 bp
  • C to T, chromosome 16 at 20,117,940 bp
  • T to C, chromosome 17 at 6,033,897 bp
  • C to T, chromosome 17 at 9,668,008 bp
  • T to A, chromosome 17 at 19,066,121 bp
  • T to A, chromosome 17 at 20,502,315 bp
  • T to C, chromosome 17 at 20,814,496 bp
  • T to C, chromosome 17 at 31,625,915 bp
  • T to A, chromosome 17 at 34,054,145 bp
  • T to A, chromosome 18 at 9,280,095 bp
  • T to C, chromosome 18 at 12,275,703 bp
  • T to A, chromosome 18 at 34,317,657 bp
  • C to A, chromosome 18 at 37,663,380 bp
  • A to T, chromosome 19 at 3,493,974 bp
  • A to T, chromosome 19 at 10,799,491 bp
  • A to T, chromosome 19 at 12,428,440 bp
  • A to T, chromosome 19 at 27,900,807 bp
  • T to G, chromosome 19 at 58,805,458 bp
  • C to T, chromosome X at 142,237,751 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9147 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068936-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.