Strain Name:
C57BL/6J-MtgxR9147Btlr/Mmmh
Stock Number:
068936-MU
Citation ID:
RRID:MMRRC_068936-MU
Other Names:
R9147 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Zdhhc17
Name: zinc finger, DHHC domain containing 17
Synonyms: A230053P19Rik, D130071N24Rik, Hip14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320150
VEGA: 10
Homologene: 56324
Nos1
Name: nitric oxide synthase 1, neuronal
Synonyms: nNOS, bNOS, Nos-1, NO, 2310005C01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18125
HGNC: HGNC:7872
Homologene: 37327
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, Macf2, bullous pemphigoid antigen 1, athetoid, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Rfx3
Name: regulatory factor X, 3 (influences HLA class II expression)
Synonyms: MRFX3, C230093O12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19726
HGNC: HGNC:9984
Homologene: 7917
Ptpa
Name: protein phosphatase 2 protein activator
Synonyms: 2610042B21Rik, Ppp2r4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110854
HGNC: HGNC:9308
Homologene: 6149
Hspa12a
Name: heat shock protein 12A
Synonyms: Hspa12a, 1700063D12Rik, Gm19925
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73442
VEGA: 19
Homologene: 18422
E2f2
Name: E2F transcription factor 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242705
HGNC: HGNC:3114
Homologene: 48264
Ppp1r13b
Name: protein phosphatase 1, regulatory subunit 13B
Synonyms: ASPP1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 21981
VEGA: 12
Homologene: 9090
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Wnk1
Name: WNK lysine deficient protein kinase 1
Synonyms: 6430573H23Rik, Prkwnk1, EG406236, Hsn2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232341
Homologene: 14253
Fuz
Name: fuzzy planar cell polarity protein
Synonyms: 2600013E07Rik, b2b1273Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70300
Homologene: 11840
Synj2
Name: synaptojanin 2
Synonyms: SJ2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20975
Homologene: 117703
Tnrc6a
Name: trinucleotide repeat containing 6a
Synonyms: CAGH26, 3110054G10Rik, D130023A07Rik, 2010321I05Rik, Tnrc6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233833
Homologene: 41399
Epb41l5
Name: erythrocyte membrane protein band 4.1 like 5
Synonyms: NBL5, 1700030C16Rik, E230025E14Rik, Lulu1, Epb4.1l5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226352
Homologene: 32492
Ppp6r3
Name: protein phosphatase 6, regulatory subunit 3
Synonyms: 9130026N02Rik, D19Bwg1430e, 4930528G08Rik, D19Ertd703e, Pp6r3, Pptcs3, Saps3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52036
VEGA: 19
HGNC: HGNC:1173
Homologene: 115911
Larp4b
Name: La ribonucleoprotein 4B
Synonyms: D13Wsu64e, Larp5, A130023E24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 217980
Homologene: 18195
Utp4
Name: UTP4 small subunit processome component
Synonyms: TEG-292, Tex292, Cirh1a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21771
HGNC: HGNC:1983
Homologene: 40775
Klhl24
Name: kelch-like 24
Synonyms: 6530402O20Rik, 1110046J11Rik, 4930429H24Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 75785
VEGA: 16
Homologene: 32352
Ufl1
Name: UFM1 specific ligase 1
Synonyms: Rcad, Maxer, 1810074P20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67490
Homologene: 9093
Tbc1d10a
Name: TBC1 domain family, member 10a
Synonyms: EPI64, Tbc1d10
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103724
Homologene: 32762
Ptprj
Name: protein tyrosine phosphatase receptor type J
Synonyms: Byp, DEP-1, Scc-1, Scc1, CD148, RPTPJ
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19271
HGNC: HGNC:9673
Homologene: 2130
Rgs2
Name: regulator of G-protein signaling 2
Synonyms: GOS8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19735
HGNC: HGNC:9998
Homologene: 2192
Rph3a
Name: rabphilin 3A
Synonyms: 2900002P20Rik, Doc2 family
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19894
Homologene: 7921
Il31ra
Name: interleukin 31 receptor A
Synonyms: GLM-R, GPL
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218624
VEGA: 13
Homologene: 51395
Apc
Name: APC, WNT signaling pathway regulator
Synonyms: Min, CC1, adenomatosis polyposis coli
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11789
HGNC: HGNC:583
Homologene: 30950
Zfp12
Name: zinc finger protein 12
Synonyms: Krox-7, Zfp-12
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231866
Homologene: 65328
2610008E11Rik
Name: RIKEN cDNA 2610008E11 gene
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72128
Homologene: 86705
Nup160
Name: nucleoporin 160
Synonyms: 2810011M03Rik, Gtl1-13
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59015
Homologene: 32509
Tspan3
Name: tetraspanin 3
Synonyms: TM4-A, Tspan-3, tetraspanin, tetraspanin TM4-A homolog, 1700055K04Rik, Tm4sf8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56434
VEGA: 9
Homologene: 21168
Edc4
Name: enhancer of mRNA decapping 4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234699
Homologene: 40937
Pdgfd
Name: platelet-derived growth factor, D polypeptide
Synonyms: 1110003I09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71785
VEGA: 9
Homologene: 11875
Adamts13
Name: ADAM metallopeptidase with thrombospondin type 1 motif 13
Synonyms: LOC279028, vWF-CP mRNA for von Willebrand factor-cleaving
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 279028
HGNC: HGNC:1366
Homologene: 16372
Foxp2
Name: forkhead box P2
Synonyms: 2810043D05Rik, D0Kist7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 114142
Homologene: 134404
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Col11a2
Name: collagen, type XI, alpha 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12815
HGNC: HGNC:2187
Homologene: 22547
Scn7a
Name: sodium channel, voltage-gated, type VII, alpha
Synonyms: Nav2.3, NaG, Nav2, 1110034K09Rik, Scn6a, Nax
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20272
Homologene: 55706
Ndst4
Name: N-deacetylase/N-sulfotransferase (heparin glucosaminyl) 4
Synonyms: 4930439H17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 64580
Homologene: 11208
Sdk2
Name: sidekick cell adhesion molecule 2
Synonyms: 5330435L01Rik, 4632412F08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237979
Homologene: 10406
Or1p1
Name: olfactory receptor family 1 subfamily P member 1
Synonyms: IH3, MOR133-3P, GA_x6K02T2P1NL-4434429-4435400, Olfr59
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18359
HGNC: HGNC:8222
Homologene: 73924
Pabpc6
Name: poly(A) binding protein, cytoplasmic 6
Synonyms: 4932702K14Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67543
VEGA: 17
Homologene: 129776
Macc1
Name: metastasis associated in colon cancer 1
Synonyms: 4732474O15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238455
Homologene: 18813
Tril
Name: TLR4 interactor with leucine-rich repeats
Synonyms: 1200009O22Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66873
Homologene: 69404
Gjd4
Name: gap junction protein, delta 4
Synonyms: connexin 39, Cx39, 9430022F06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225152
VEGA: 18
Homologene: 17692
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Vmn2r80
Name: vomeronasal 2, receptor 80
Synonyms: EG624765
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624765
Homologene: 83483
Galntl5
Name: UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5
Synonyms: 1700021B12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67909
Homologene: 12210
Moxd2
Name: monooxygenase, DBH-like 2
Synonyms: Dbhl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194357
Homologene: 77226
Fbxo2
Name: F-box protein 2
Synonyms: NFB42, FBX2, Fbs1, Prpl4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230904
Homologene: 8132
Sacs
Name: sacsin
Synonyms: E130115J16Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50720
Ctsj
Name: cathepsin J
Synonyms: rat gene/Cathepsin L-related protein, CatRLP, CATP, Cat P, Ctsp
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26898
VEGA: 13
Homologene: 137246
Cacnb2
Name: calcium channel, voltage-dependent, beta 2 subunit
Synonyms: Cchb2, Cavbeta2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12296
HGNC: HGNC:1402
Homologene: 75191
C1s1
Name: complement component 1, s subcomponent 1
Synonyms: C1s
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50908
HGNC: HGNC:1247
Homologene: 1314
Megf6
Name: multiple EGF-like-domains 6
Synonyms: 2600001P17Rik, Egfl3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230971
HGNC: HGNC:3232
Homologene: 45412
Dennd3
Name: DENN domain containing 3
Synonyms: E030003N15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105841
Homologene: 28254
Serpinf2
Name: serine (or cysteine) peptidase inhibitor, clade F, member 2
Synonyms: alpha 2 antiplasmin, Pli
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18816
HGNC: HGNC:9075
Homologene: 719
Vmn2r98
Name: vomeronasal 2, receptor 98
Synonyms: EG224552
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224552
Homologene: 115024
A430033K04Rik
Name: RIKEN cDNA A430033K04 gene
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243308
Homologene: 65621
Gramd1a
Name: GRAM domain containing 1A
Synonyms: 1300003M23Rik, D7Bwg0611e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52857
Homologene: 10843
Ssbp2
Name: single-stranded DNA binding protein 2
Synonyms: Hspc116, 2310079I02Rik, 9330163K02Rik, 1500004K09Rik, A830008M03Rik, Ssdp2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66970
Homologene: 22724
Vmn1r176
Name: vomeronasal 1 receptor 176
Synonyms: Gm5998
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546943
Homologene: 128341
Mael
Name: maelstrom spermatogenic transposon silencer
Synonyms: 4933405K18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98558
Homologene: 13143
Tafa5
Name: TAFA chemokine like family member 5
Synonyms: Tara-5, Fam19a5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106014
VEGA: 15
Homologene: 22888
Pfpl
Name: pore forming protein-like
Synonyms: Epcs5, Epcs50
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56093
VEGA: 19
Homologene: 130704
Or7h8
Name: olfactory receptor family 7 subfamily H member 8
Synonyms: GA_x6K02T2PVTD-13952555-13953490, MOR141-2, Olfr871
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258905
Homologene: 138319
Cbs
Name: cystathionine beta-synthase
Synonyms: HIP4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12411
HGNC: HGNC:1550
Homologene: 37258
Fmn1
Name: formin 1
Synonyms: Fmn, formin-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14260
HGNC: HGNC:3768
Homologene: 121778
Or1j19
Name: olfactory receptor family 1 subfamily J member 19
Synonyms: GA_x6K02T2NLDC-33481050-33481991, MOR136-8, Olfr348
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258946
HGNC: HGNC:8209
Homologene: 105219
Itgax
Name: integrin alpha X
Synonyms: CD11C (p150) alpha polypeptide, Cd11c, CR4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16411
HGNC: HGNC:6152
Homologene: 55493
Sdr16c5
Name: short chain dehydrogenase/reductase family 16C, member 5
Synonyms: Scdr9, Rdhe2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242285
Homologene: 15039
Foxj1
Name: forkhead box J1
Synonyms: Hfh4, FKHL-13, HFH-4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15223
HGNC: HGNC:3816
Homologene: 1117
Pih1d2
Name: PIH1 domain containing 2
Synonyms: 2700059L22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72614
Homologene: 12474
Zfp330
Name: zinc finger protein 330
Synonyms: nucleolar autoantigen 36, NOA 36, Noa36
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 30932
Homologene: 8714
Or8k24
Name: olfactory receptor family 8 subfamily K member 24
Synonyms: GA_x6K02T2Q125-47855818-47854868, MOR190-2, Olfr1058
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258386
Homologene: 74093
1110032F04Rik
Name: RIKEN cDNA 1110032F04 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68725
Homologene: 110165
Ccdc136
Name: coiled-coil domain containing 136
Synonyms: 4921511K06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232664
Homologene: 23378
Zfp444
Name: zinc finger protein 444
Synonyms: 2810031J10Rik, 6230401O10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72667
Homologene: 10139
Tmem132b
Name: transmembrane protein 132B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208151
Homologene: 28135
Ankrd29
Name: ankyrin repeat domain 29
Synonyms: G630054C21Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225187
Homologene: 17839
Nherf4
Name: NHERF family PDZ scaffold protein 4
Synonyms: sodium-phosphate cotransporter IIa C-terminal-associated protein 2, NaPi-Cap2, Pdzk2, Pdzd3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 170761
VEGA: 9
Homologene: 11719
Vmn1r225
Name: vomeronasal 1 receptor 225
Synonyms: V1re5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171228
Hs3st5
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 5
Synonyms: LOC382362, D930005L05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 319415
Homologene: 17796
Vmn1r229
Name: vomeronasal 1 receptor 229
Synonyms: V1re1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171224
Homologene: 74319
Sebox
Name: SEBOX homeobox
Synonyms: OG9, Og9x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18292
Homologene: 32052
Slc2a10
Name: solute carrier family 2 (facilitated glucose transporter), member 10
Synonyms: Glut10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170441
Homologene: 38551
Or5c1
Name: olfactory receptor family 5 subfamily C member 1
Synonyms: GA_x6K02T2NLDC-34015743-34016726, MOR178-1, Olfr368
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258371
HGNC: HGNC:8331
Homologene: 71970
Cd6
Name: CD6 antigen
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12511
HGNC: HGNC:1691
Homologene: 4893
Imp4
Name: IMP4, U3 small nucleolar ribonucleoprotein
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27993
Homologene: 68891
Gzmb
Name: granzyme B
Synonyms: CCP1, CCP-1/C11, Ctla-1, Ctla1, GZB
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14939
VEGA: 14
HGNC: HGNC:4709
Six4
Name: sine oculis-related homeobox 4
Synonyms: AREC3, TrexBF
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20474
Homologene: 69089
Pcdhga1
Name: protocadherin gamma subfamily A, 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93709
HGNC: HGNC:8696
Homologene: 56824
Rasd2
Name: RASD family, member 2
Synonyms: TEM2, TEM-2, Rhes, 4930526B11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75141
Homologene: 8628
Mettl6
Name: methyltransferase 6, methylcytidine
Synonyms: 1600013P15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67011
VEGA: 14
Homologene: 12069
Scgb1b3
Name: secretoglobin, family 1B, member 3
Synonyms: Gm5325, Abpa3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384585
Homologene: 114479
Nxt2
Name: nuclear transport factor 2-like export factor 2
Synonyms: P15-2, 6330587F24Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 237082
Homologene: 10273
Ighv4-1
Name: immunoglobulin heavy variable 4-1
Synonyms: Gm16612
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 780802
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,189,068 bp
  • G to T, chromosome 1 at 34,443,392 bp
  • A to T, chromosome 1 at 119,642,589 bp
  • A to G, chromosome 1 at 144,002,187 bp
  • A to G, chromosome 1 at 166,201,690 bp
  • G to A, chromosome 2 at 14,967,962 bp
  • T to A, chromosome 2 at 26,993,012 bp
  • T to A, chromosome 2 at 30,438,243 bp
  • G to T, chromosome 2 at 30,438,244 bp
  • A to G, chromosome 2 at 36,786,926 bp
  • T to C, chromosome 2 at 37,332,005 bp
  • T to C, chromosome 2 at 66,684,163 bp
  • A to G, chromosome 2 at 86,385,980 bp
  • G to A, chromosome 2 at 90,458,218 bp
  • A to G, chromosome 2 at 90,703,145 bp
  • A to C, chromosome 2 at 113,441,628 bp
  • A to T, chromosome 2 at 165,515,623 bp
  • T to A, chromosome 3 at 68,870,012 bp
  • C to T, chromosome 3 at 125,438,073 bp
  • T to C, chromosome 4 at 3,996,200 bp
  • A to T, chromosome 4 at 25,278,712 bp
  • A to T, chromosome 4 at 136,181,284 bp
  • A to G, chromosome 4 at 148,165,709 bp
  • A to G, chromosome 4 at 154,254,673 bp
  • A to T, chromosome 5 at 25,210,355 bp
  • G to C, chromosome 5 at 117,879,337 bp
  • T to C, chromosome 5 at 120,948,817 bp
  • C to A, chromosome 5 at 125,787,103 bp
  • T to A, chromosome 5 at 138,646,285 bp
  • T to C, chromosome 5 at 143,244,634 bp
  • A to T, chromosome 6 at 15,286,712 bp
  • A to G, chromosome 6 at 29,418,071 bp
  • C to A, chromosome 6 at 40,884,044 bp
  • A to G, chromosome 6 at 53,818,152 bp
  • TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG, chromosome 6 at 99,075,905 bp
  • A to G, chromosome 6 at 119,948,670 bp
  • T to C, chromosome 6 at 124,540,799 bp
  • A to G, chromosome 7 at 6,189,679 bp
  • C to T, chromosome 7 at 23,835,360 bp
  • A to T, chromosome 7 at 31,138,181 bp
  • G to A, chromosome 7 at 31,375,626 bp
  • C to T, chromosome 7 at 44,900,286 bp
  • T to G, chromosome 7 at 123,186,444 bp
  • A to G, chromosome 7 at 128,148,741 bp
  • C to T, chromosome 8 at 75,222,219 bp
  • T to C, chromosome 8 at 82,764,434 bp
  • T to C, chromosome 8 at 105,885,846 bp
  • A to T, chromosome 8 at 106,894,678 bp
  • A to T, chromosome 9 at 6,333,328 bp
  • T to A, chromosome 9 at 20,213,062 bp
  • A to G, chromosome 9 at 44,249,379 bp
  • T to A, chromosome 9 at 50,621,021 bp
  • A to T, chromosome 9 at 56,136,676 bp
  • A to T, chromosome 10 at 36,832,921 bp
  • A to G, chromosome 10 at 52,050,943 bp
  • A to T, chromosome 10 at 79,067,572 bp
  • A to T, chromosome 10 at 79,194,853 bp
  • A to T, chromosome 10 at 110,949,642 bp
  • G to T, chromosome 11 at 4,186,835 bp
  • A to T, chromosome 11 at 62,333,846 bp
  • A to C, chromosome 11 at 74,289,343 bp
  • A to T, chromosome 11 at 75,432,592 bp
  • A to G, chromosome 11 at 78,504,396 bp
  • C to T, chromosome 11 at 113,823,400 bp
  • T to G, chromosome 11 at 116,334,410 bp
  • A to C, chromosome 12 at 73,108,907 bp
  • A to G, chromosome 12 at 75,890,384 bp
  • T to C, chromosome 12 at 111,833,834 bp
  • A to T, chromosome 12 at 113,948,380 bp
  • T to C, chromosome 12 at 119,450,356 bp
  • C to A, chromosome 13 at 9,136,783 bp
  • T to C, chromosome 13 at 61,001,435 bp
  • T to C, chromosome 13 at 91,694,022 bp
  • C to T, chromosome 13 at 112,533,742 bp
  • T to C, chromosome 14 at 31,482,898 bp
  • T to C, chromosome 14 at 56,259,507 bp
  • T to C, chromosome 14 at 61,212,688 bp
  • T to A, chromosome 15 at 73,557,614 bp
  • T to C, chromosome 15 at 87,544,574 bp
  • C to T, chromosome 16 at 20,117,940 bp
  • T to C, chromosome 17 at 6,033,897 bp
  • C to T, chromosome 17 at 9,668,008 bp
  • T to A, chromosome 17 at 19,066,121 bp
  • T to A, chromosome 17 at 20,502,315 bp
  • T to C, chromosome 17 at 20,814,496 bp
  • T to C, chromosome 17 at 31,625,915 bp
  • T to A, chromosome 17 at 34,054,145 bp
  • T to A, chromosome 18 at 9,280,095 bp
  • T to C, chromosome 18 at 12,275,703 bp
  • T to A, chromosome 18 at 34,317,657 bp
  • C to A, chromosome 18 at 37,663,380 bp
  • A to T, chromosome 19 at 3,493,974 bp
  • A to T, chromosome 19 at 10,799,491 bp
  • A to T, chromosome 19 at 12,428,440 bp
  • A to T, chromosome 19 at 27,900,807 bp
  • T to G, chromosome 19 at 58,805,458 bp
  • C to T, chromosome X at 142,237,751 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9147 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068936-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.