Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9155Btlr/Mmmh
Stock Number:
068941-MU
Citation ID:
RRID:MMRRC_068941-MU
Other Names:
R9155 (G1)
Major Collection:

Strain Information

Itga8
Name: integrin alpha 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Slc27a4
Name: solute carrier family 27 (fatty acid transporter), member 4
Synonyms: fatty acid transport protein 4, FATP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26569
Homologene: 68437
Nsd1
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Mga
Name: MAX gene associated
Synonyms: Mga, Mad5, C130042M01Rik, D030062C11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 29808
Homologene: 49351
Ppp4c
Name: protein phosphatase 4, catalytic subunit
Synonyms: PPX, 1110002D08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56420
HGNC: HGNC:9319
Homologene: 2038
Mbtps1
Name: membrane-bound transcription factor peptidase, site 1
Synonyms: subtilisin/kexin isozyme-1, SKI-1, S1P, 0610038M03Rik, site-1 protease
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56453
Homologene: 2808
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 4,492,224 bp
  • C to A, chromosome 1 at 60,150,683 bp
  • A to G, chromosome 1 at 75,509,489 bp
  • T to A, chromosome 1 at 90,810,579 bp
  • C to A, chromosome 1 at 132,494,285 bp
  • A to G, chromosome 2 at 12,189,519 bp
  • G to A, chromosome 2 at 29,811,282 bp
  • A to C, chromosome 2 at 37,085,004 bp
  • T to A, chromosome 2 at 69,461,369 bp
  • C to T, chromosome 2 at 76,795,593 bp
  • A to G, chromosome 2 at 105,378,779 bp
  • T to C, chromosome 2 at 119,926,532 bp
  • A to G, chromosome 2 at 120,924,134 bp
  • G to A, chromosome 2 at 125,775,703 bp
  • T to C, chromosome 2 at 130,658,307 bp
  • A to G, chromosome 2 at 156,008,860 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • T to A, chromosome 2 at 180,717,963 bp
  • A to G, chromosome 3 at 30,914,542 bp
  • A to G, chromosome 3 at 86,295,201 bp
  • T to C, chromosome 4 at 98,778,326 bp
  • A to G, chromosome 5 at 107,543,945 bp
  • A to T, chromosome 5 at 108,996,346 bp
  • A to G, chromosome 5 at 115,295,780 bp
  • A to G, chromosome 5 at 124,830,411 bp
  • A to C, chromosome 6 at 127,150,700 bp
  • A to T, chromosome 7 at 10,047,644 bp
  • C to T, chromosome 7 at 44,304,893 bp
  • A to T, chromosome 7 at 66,409,119 bp
  • A to T, chromosome 7 at 126,787,247 bp
  • T to C, chromosome 7 at 130,394,733 bp
  • T to A, chromosome 8 at 66,513,206 bp
  • T to C, chromosome 8 at 105,393,939 bp
  • A to G, chromosome 8 at 105,686,290 bp
  • T to C, chromosome 8 at 110,881,752 bp
  • T to C, chromosome 8 at 119,508,954 bp
  • G to T, chromosome 9 at 15,089,079 bp
  • A to T, chromosome 9 at 19,585,083 bp
  • A to T, chromosome 9 at 31,054,013 bp
  • T to A, chromosome 9 at 106,075,010 bp
  • T to C, chromosome 10 at 34,126,367 bp
  • C to T, chromosome 10 at 60,413,706 bp
  • A to T, chromosome 10 at 82,284,369 bp
  • T to C, chromosome 10 at 103,214,779 bp
  • A to G, chromosome 11 at 9,006,056 bp
  • A to G, chromosome 11 at 60,707,108 bp
  • G to T, chromosome 11 at 73,125,263 bp
  • A to G, chromosome 11 at 74,364,965 bp
  • A to G, chromosome 11 at 80,257,554 bp
  • T to A, chromosome 11 at 80,894,046 bp
  • T to A, chromosome 11 at 94,459,597 bp
  • A to T, chromosome 11 at 102,438,671 bp
  • T to A, chromosome 12 at 108,193,719 bp
  • T to A, chromosome 12 at 110,914,750 bp
  • C to T, chromosome 12 at 118,027,516 bp
  • A to T, chromosome 13 at 23,012,173 bp
  • C to T, chromosome 13 at 55,213,440 bp
  • T to C, chromosome 13 at 97,177,906 bp
  • A to T, chromosome 14 at 24,296,870 bp
  • T to C, chromosome 14 at 69,192,211 bp
  • T to A, chromosome 14 at 72,683,722 bp
  • C to A, chromosome 15 at 47,585,655 bp
  • T to C, chromosome 15 at 100,774,690 bp
  • A to C, chromosome 16 at 4,096,482 bp
  • C to T, chromosome 16 at 64,926,425 bp
  • G to A, chromosome 17 at 35,621,239 bp
  • A to T, chromosome 17 at 38,335,333 bp
  • T to C, chromosome 17 at 55,610,207 bp
  • T to C, chromosome 17 at 57,066,796 bp
  • T to C, chromosome 18 at 14,813,239 bp
  • A to T, chromosome 19 at 4,009,912 bp
  • G to A, chromosome 19 at 12,999,064 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9155 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068941-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.