Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9155Btlr/Mmmh
Stock Number:
068941-MU
Citation ID:
RRID:MMRRC_068941-MU
Other Names:
R9155 (G1)
Major Collection:

Strain Information

Itga8
Name: integrin alpha 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Slc27a4
Name: solute carrier family 27 (fatty acid transporter), member 4
Synonyms: fatty acid transport protein 4, FATP4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26569
Homologene: 68437
Nsd1
Name: nuclear receptor-binding SET-domain protein 1
Synonyms: KMT3B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18193
VEGA: 13
Homologene: 32543
Mga
Name: MAX gene associated
Synonyms: Mga, Mad5, C130042M01Rik, D030062C11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 29808
Homologene: 49351
Ppp4c
Name: protein phosphatase 4, catalytic subunit
Synonyms: PPX, 1110002D08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56420
HGNC: HGNC:9319
Homologene: 2038
Mbtps1
Name: membrane-bound transcription factor peptidase, site 1
Synonyms: subtilisin/kexin isozyme-1, SKI-1, S1P, 0610038M03Rik, site-1 protease
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56453
Homologene: 2808
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Ndufv1
Name: NADH:ubiquinone oxidoreductase core subunit V1
Synonyms: 24 kDa (FP)
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 17995
HGNC: HGNC:7716
Homologene: 5151
Lrba
Name: LPS-responsive beige-like anchor
Synonyms: Lba, D3Ertd775e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80877
HGNC: HGNC:1742
Homologene: 36205
Ubr1
Name: ubiquitin protein ligase E3 component n-recognin 1
Synonyms: E3 alpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22222
Homologene: 7582
Rbbp5
Name: retinoblastoma binding protein 5, histone lysine methyltransferase complex subunit
Synonyms: 4933411J24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213464
HGNC: HGNC:9888
Homologene: 3709
Fndc3a
Name: fibronectin type III domain containing 3A
Synonyms: 1700094E19Rik, F730017H24Rik, D14Ertd453e, Fndc3, sys
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319448
Homologene: 8952
Cog4
Name: component of oligomeric golgi complex 4
Synonyms: D8Ertd515e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102339
Homologene: 7155
Ccnk
Name: cyclin K
Synonyms: CPR4, CycK
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 12454
VEGA: 12
HGNC: HGNC:1596
Homologene: 14748
Secisbp2l
Name: SECIS binding protein 2-like
Synonyms: 3110001I20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70354
Homologene: 18923
Hus1
Name: HUS1 checkpoint clamp component
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15574
HGNC: HGNC:5309
Homologene: 37932
Htr1f
Name: 5-hydroxytryptamine (serotonin) receptor 1F
Synonyms: Htr1eb
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15557
VEGA: 16
HGNC: HGNC:5292
Homologene: 37361
Rhot1
Name: ras homolog family member T1
Synonyms: Miro1, 2210403N23Rik, FLJ11040, Arht1, C430039G08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 59040
Homologene: 56803
Crebbp
Name: CREB binding protein
Synonyms: CBP, KAT3A
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12914
HGNC: HGNC:2348
Homologene: 68393
Coq5
Name: coenzyme Q5 methyltransferase
Synonyms: 1810014G04Rik, D5Ertd33e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52064
Homologene: 6559
Kank4
Name: KN motif and ankyrin repeat domains 4
Synonyms: Ankrd38
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242553
Homologene: 18244
Ddrgk1
Name: DDRGK domain containing 1
Synonyms: 1110001I20Rik, 2600009E05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77006
Homologene: 11400
Tecpr2
Name: tectonin beta-propeller repeat containing 2
Synonyms: 4930573I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104859
VEGA: 12
Homologene: 8897
Taf4b
Name: TATA-box binding protein associated factor 4b
Synonyms: Taf2c2, TAFII105, 105kDa, 2610524B04Rik, 4932409F03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72504
VEGA: 18
Homologene: 28266
Pigt
Name: phosphatidylinositol glycan anchor biosynthesis, class T
Synonyms: CGI-06, 4930534E15Rik, Ndap7, NDAP, 2510012P17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78928
Homologene: 6134
Zbtb44
Name: zinc finger and BTB domain containing 44
Synonyms: 6030404E16Rik, Btbd15
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235132
VEGA: 9
Homologene: 18221
Sox17
Name: SRY (sex determining region Y)-box 17
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20671
Homologene: 7948
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Dennd1c
Name: DENN domain containing 1C
Synonyms: 4432409M07Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70785
VEGA: 17
Homologene: 11773
Itgae
Name: integrin alpha E, epithelial-associated
Synonyms: CD103, alpha-E1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16407
HGNC: HGNC:6147
Homologene: 113560
Calhm6
Name: calcium homeostasis modulator family member 6
Synonyms: A630077B13Rik, Fam26f
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215900
VEGA: 10
Homologene: 25235
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Dnah11
Name: dynein, axonemal, heavy chain 11
Synonyms: lrd, b2b1279Clo, b2b1203Clo, b2b598Clo, b2b1289Clo, b2b1727Clo, Dnahc11, avc4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13411
HGNC: HGNC:2942
Homologene: 2801
Kctd19
Name: potassium channel tetramerisation domain containing 19
Synonyms: 4922504H04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 279499
Homologene: 18630
Hephl1
Name: hephaestin-like 1
Synonyms: LOC244698, Zp, zyklopen, thd, cw
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244698
Homologene: 9112
Slc4a8
Name: solute carrier family 4 (anion exchanger), member 8
Synonyms: sodium bicarbonate cotransporter isoform 3 kNBC-3, KNBC-3, NDCBE
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 59033
Homologene: 68419
Vmn1r213
Name: vomeronasal 1 receptor 213
Synonyms: V1rh6
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171249
Homologene: 110880
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Vmn2r10
Name: vomeronasal 2, receptor 10
Synonyms: VR16, V2r16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22307
Homologene: 129606
Clec11a
Name: C-type lectin domain family 11, member a
Synonyms: Clecsf3, Scgf
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20256
Homologene: 2236
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Lrriq1
Name: leucine-rich repeats and IQ motif containing 1
Synonyms: LOC380658, 4930503E15Rik, Gm1557
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74978
Homologene: 46007
Col6a4
Name: collagen, type VI, alpha 4
Synonyms: EG235580, 1110001D15Rik, Dvwa, Vwa6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68553
Homologene: 130754
Ccnd2
Name: cyclin D2
Synonyms: Vin-1, Vin1, 2600016F06Rik, cD2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12444
HGNC: HGNC:1583
Homologene: 37525
Gid8
Name: GID complex subunit 8
Synonyms: 2310003C23Rik, 4833420G11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76425
Homologene: 41207
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Fam171a2
Name: family with sequence similarity 171, member A2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217219
Homologene: 19144
Ergic3
Name: ERGIC and golgi 3
Synonyms: CGI-54, NY-BR-84, 2310015B14Rik, D2Ucla1, Sdbcag84
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66366
Homologene: 5289
Them7
Name: thioesterase superfamily member 7
Synonyms: 0610012H03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74088
Homologene: 105742
Or1d2
Name: olfactory receptor family 1 subfamily D member 2
Synonyms: GA_x6K02T2P1NL-4500587-4501525, MOR127-5P, Olfr412
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258153
Homologene: 37634
Aldh1a3
Name: aldehyde dehydrogenase family 1, subfamily A3
Synonyms: ALDH6, V1, retinaldehyde dehydrogenase 3, RALDH3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56847
HGNC: HGNC:409
Homologene: 68080
Llgl1
Name: LLGL1 scribble cell polarity complex component
Synonyms: Lgl1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16897
HGNC: HGNC:6628
Homologene: 31220
Or2n1d
Name: olfactory receptor family 2 subfamily N member 1D
Synonyms: MOR256-7, GA_x6K02T2PSCP-2779375-2780313, Olfr136
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258803
Homologene: 119758
Vmn2r118
Name: vomeronasal 2, receptor 118
Synonyms: EG668547, Vmn2r119, EG383258
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 383258
Homologene: 129687
Hexb
Name: hexosaminidase B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15212
VEGA: 13
HGNC: HGNC:4879
Homologene: 437
Or5b99
Name: olfactory receptor family 5 subfamily B member 99
Synonyms: GA_x6K02T2RE5P-3328502-3329434, MOR202-1, Olfr1451
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258700
HGNC: HGNC:8323
Homologene: 128082
Muc21
Name: mucin 21
Synonyms: epiglycanin, Gm9573
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 672682
Carf
Name: calcium response factor
Synonyms: Als2cr8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241066
Homologene: 11689
Or7g35
Name: olfactory receptor family 7 subfamily G member 35
Synonyms: GA_x6K02T2PVTD-13330461-13331399, MOR148-1, Olfr855
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258517
HGNC: HGNC:8466
Homologene: 74176
Nkx3-1
Name: NK3 homeobox 1
Synonyms: Bax, bagpipe, Nkx-3.1, NKX3A, NKX3.1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18095
HGNC: HGNC:7838
Homologene: 4494
1700028K03Rik
Name: RIKEN cDNA 1700028K03 gene
Synonyms: SCRE, Spo16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76421
Homologene: 18810
Vmn2r50
Name: vomeronasal 2, receptor 50
Synonyms: EG434117
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434117
Homologene: 113703
Tktl2
Name: transketolase-like 2
Synonyms: 4933401I19Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74419
Homologene: 69456
Carmil2
Name: capping protein regulator and myosin 1 linker 2
Synonyms: D130029J02Rik, Rltpr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234695
Homologene: 128439
E330034G19Rik
Name: RIKEN cDNA E330034G19 gene
Synonyms: ZPAC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105418
Or12k8
Name: olfactory receptor family 12 subfamily K member 8
Synonyms: GA_x6K02T2NLDC-33777519-33776551, MOR159-3, Olfr361
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258365
Homologene: 27142
Asic2
Name: acid-sensing ion channel 2
Synonyms: Mdeg, BNaC1a, BNC1, Accn1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11418
HGNC: HGNC:99
Homologene: 137202
Phc3
Name: polyhomeotic 3
Synonyms: EDR3, HPH3, E030046K01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241915
Homologene: 69390
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 4,492,224 bp
  • C to A, chromosome 1 at 60,150,683 bp
  • A to G, chromosome 1 at 75,509,489 bp
  • T to A, chromosome 1 at 90,810,579 bp
  • C to A, chromosome 1 at 132,494,285 bp
  • A to G, chromosome 2 at 12,189,519 bp
  • G to A, chromosome 2 at 29,811,282 bp
  • A to C, chromosome 2 at 37,085,004 bp
  • T to A, chromosome 2 at 69,461,369 bp
  • C to T, chromosome 2 at 76,795,593 bp
  • A to G, chromosome 2 at 105,378,779 bp
  • T to C, chromosome 2 at 119,926,532 bp
  • A to G, chromosome 2 at 120,924,134 bp
  • G to A, chromosome 2 at 125,775,703 bp
  • T to C, chromosome 2 at 130,658,307 bp
  • A to G, chromosome 2 at 156,008,860 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • T to A, chromosome 2 at 180,717,963 bp
  • A to G, chromosome 3 at 30,914,542 bp
  • A to G, chromosome 3 at 86,295,201 bp
  • T to C, chromosome 4 at 98,778,326 bp
  • A to G, chromosome 5 at 107,543,945 bp
  • A to T, chromosome 5 at 108,996,346 bp
  • A to G, chromosome 5 at 115,295,780 bp
  • A to G, chromosome 5 at 124,830,411 bp
  • A to C, chromosome 6 at 127,150,700 bp
  • A to T, chromosome 7 at 10,047,644 bp
  • C to T, chromosome 7 at 44,304,893 bp
  • A to T, chromosome 7 at 66,409,119 bp
  • A to T, chromosome 7 at 126,787,247 bp
  • T to C, chromosome 7 at 130,394,733 bp
  • T to A, chromosome 8 at 66,513,206 bp
  • T to C, chromosome 8 at 105,393,939 bp
  • A to G, chromosome 8 at 105,686,290 bp
  • T to C, chromosome 8 at 110,881,752 bp
  • T to C, chromosome 8 at 119,508,954 bp
  • G to T, chromosome 9 at 15,089,079 bp
  • A to T, chromosome 9 at 19,585,083 bp
  • A to T, chromosome 9 at 31,054,013 bp
  • T to A, chromosome 9 at 106,075,010 bp
  • T to C, chromosome 10 at 34,126,367 bp
  • C to T, chromosome 10 at 60,413,706 bp
  • A to T, chromosome 10 at 82,284,369 bp
  • T to C, chromosome 10 at 103,214,779 bp
  • A to G, chromosome 11 at 9,006,056 bp
  • A to G, chromosome 11 at 60,707,108 bp
  • G to T, chromosome 11 at 73,125,263 bp
  • A to G, chromosome 11 at 74,364,965 bp
  • A to G, chromosome 11 at 80,257,554 bp
  • T to A, chromosome 11 at 80,894,046 bp
  • T to A, chromosome 11 at 94,459,597 bp
  • A to T, chromosome 11 at 102,438,671 bp
  • T to A, chromosome 12 at 108,193,719 bp
  • T to A, chromosome 12 at 110,914,750 bp
  • C to T, chromosome 12 at 118,027,516 bp
  • A to T, chromosome 13 at 23,012,173 bp
  • C to T, chromosome 13 at 55,213,440 bp
  • T to C, chromosome 13 at 97,177,906 bp
  • A to T, chromosome 14 at 24,296,870 bp
  • T to C, chromosome 14 at 69,192,211 bp
  • T to A, chromosome 14 at 72,683,722 bp
  • C to A, chromosome 15 at 47,585,655 bp
  • T to C, chromosome 15 at 100,774,690 bp
  • A to C, chromosome 16 at 4,096,482 bp
  • C to T, chromosome 16 at 64,926,425 bp
  • G to A, chromosome 17 at 35,621,239 bp
  • A to T, chromosome 17 at 38,335,333 bp
  • T to C, chromosome 17 at 55,610,207 bp
  • T to C, chromosome 17 at 57,066,796 bp
  • T to C, chromosome 18 at 14,813,239 bp
  • A to T, chromosome 19 at 4,009,912 bp
  • G to A, chromosome 19 at 12,999,064 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9155 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068941-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.