Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9173Btlr/Mmmh
Stock Number:
068947-MU
Citation ID:
RRID:MMRRC_068947-MU
Other Names:
R9173 (G1)
Major Collection:

Strain Information

Tet1
Name: tet methylcytosine dioxygenase 1
Synonyms: 2510010B09Rik, D10Ertd17e, Cxxc6, BB001228
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52463
Homologene: 12735
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Ppil2
Name: peptidylprolyl isomerase (cyclophilin)-like 2
Synonyms: C130078A06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66053
HGNC: HGNC:9261
Homologene: 8643
Fkbp9
Name: FK506 binding protein 9
Synonyms: FKBP60, FKBP63
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27055
HGNC: HGNC:3725
Homologene: 31434
Dnajc17
Name: DnaJ heat shock protein family (Hsp40) member C17
Synonyms: D9Bwg1371e, 1700025B16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69408
Homologene: 49527
Kat8
Name: K(lysine) acetyltransferase 8
Synonyms: D7Ertd629e, 5830450F21Rik, 2010203C02Rik, MOF, Myst1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67773
Homologene: 41676
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Relch
Name: RAB11 binding and LisH domain, coiled-coil and HEAT repeat containing
Synonyms: 2310035C23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227446
Homologene: 10834
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Ube4b
Name: ubiquitination factor E4B
Synonyms: UFD2, 4933406G05Rik, 4930551I19Rik, UFD2a, D4Bwg0973e, Ufd2p
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 63958
Homologene: 107623
Eftud2
Name: elongation factor Tu GTP binding domain containing 2
Synonyms: U5-116kD, 116kDa, Snrp116
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20624
Homologene: 3133
Nop14
Name: NOP14 nucleolar protein
Synonyms: 2610033H07Rik, Nol14
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75416
Homologene: 41773
Cyp51
Name: cytochrome P450, family 51
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13121
HGNC: HGNC:2649
Homologene: 55488
Slit2
Name: slit guidance ligand 2
Synonyms: Slil3, Drad-1, E130320P19Rik, E030015M03Rik, b2b1200.1Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20563
Homologene: 3516
Jcad
Name: junctional cadherin 5 associated
Synonyms: 9430020K01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240185
VEGA: 18
Homologene: 19370
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Nxn
Name: nucleoredoxin
Synonyms: l11Jus13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18230
Homologene: 69028
Stau2
Name: staufen double-stranded RNA binding protein 2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 29819
Homologene: 8666
Sec31a
Name: SEC31 homolog A, COPII coat complex component
Synonyms: 1810024J13Rik, Sec31l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69162
Homologene: 42056
Clstn1
Name: calsyntenin 1
Synonyms: calsyntenin-1, Cst-1, 1810034E21Rik, alcadein alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 65945
Homologene: 8814
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Mycbpap
Name: MYCBP associated protein
Synonyms: AMAP-1, 4932408B01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104601
Homologene: 49982
Kcnu1
Name: potassium channel, subfamily U, member 1
Synonyms: Slo3, Kcnma3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16532
Homologene: 7392
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Sorcs1
Name: sortilin-related VPS10 domain containing receptor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 58178
Homologene: 10967
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Hrc
Name: histidine rich calcium binding protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15464
HGNC: HGNC:5178
Homologene: 137234
Fgd5
Name: FYVE, RhoGEF and PH domain containing 5
Synonyms: ZFYVE23, C330025N11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232237
Homologene: 27798
Usp29
Name: ubiquitin specific peptidase 29
Synonyms: Ocat
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57775
Homologene: 49641
Map6
Name: microtubule-associated protein 6
Synonyms: F-STOP, STOP, 2810411E12Rik, Mtap6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17760
HGNC: HGNC:6868
Homologene: 7850
Pcyox1l
Name: prenylcysteine oxidase 1 like
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240334
Homologene: 23429
Cpd
Name: carboxypeptidase D
Synonyms: D830034L15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12874
HGNC: HGNC:2301
Homologene: 999
Slco1a4
Name: solute carrier organic anion transporter family, member 1a4
Synonyms: Oatp2, Slc21a5, Oatp1a4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 28250
Homologene: 130782
Itgal
Name: integrin alpha L
Synonyms: LFA-1, Cd11a, Ly-21, Ly-15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16408
HGNC: HGNC:6148
Homologene: 1666
Serpina1c
Name: serine (or cysteine) peptidase inhibitor, clade A, member 1C
Synonyms: PI6, PI3, Spi1-3, Spi1-6
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20702
HGNC: HGNC:8941
Homologene: 20103
Vmn2r114
Name: vomeronasal 2, receptor 114
Synonyms: EG666002
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 666002
Homologene: 86604
Zfp11
Name: zinc finger protein 11
Synonyms: Krox-6, Zfp-11
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22648
Homologene: 87241
Spata7
Name: spermatogenesis associated 7
Synonyms: HSD3, B230306G18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104871
Homologene: 10189
Ercc4
Name: excision repair cross-complementing rodent repair deficiency, complementation group 4
Synonyms: Xpf
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50505
HGNC: HGNC:3436
Homologene: 3836
Spata31e5
Name: spermatogenesis associated 31 subfamily E member 5
Synonyms: LOC210962, Gm597
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210962
Exd2
Name: exonuclease 3'-5' domain containing 2
Synonyms: 4930539P14Rik, Exdl2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 97827
VEGA: 12
Homologene: 10066
Ctnna2
Name: catenin alpha 2
Synonyms: alpha(N)-catenin, alpha N-catenin, Catna, chp, Catna2, catenin (cadherin associated protein), alpha 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12386
HGNC: HGNC:2510
Homologene: 68394
Tubal3
Name: tubulin, alpha-like 3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238463
VEGA: 13
Homologene: 23488
H2-Eb2
Name: histocompatibility 2, class II antigen E beta2
Synonyms: H-2Eb2, Ia-5, Ia5, A130038H09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381091
Homologene: 128636
Klk15
Name: kallikrein related-peptidase 15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 317652
Homologene: 77571
Acaa1a
Name: acetyl-Coenzyme A acyltransferase 1A
Synonyms: peroxisomal 3-ketoacyl-CoA thiolase, PTL, D9Ertd25e, Acaa1, thiolase A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 113868
HGNC: HGNC:82
Homologene: 37497
H2bc21
Name: H2B clustered histone 21
Synonyms: Hist2h2be
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 319190
HGNC: HGNC:4761
Homologene: 128594
Trafd1
Name: TRAF type zinc finger domain containing 1
Synonyms: 1110008K06Rik, Fln29
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231712
Homologene: 31399
Sytl3
Name: synaptotagmin-like 3
Synonyms: Slp3-a, Slp3-b, Slp3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 83672
Homologene: 12855
Rnft1
Name: ring finger protein, transmembrane 1
Synonyms: 0610013E23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76892
Homologene: 41110
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Pyst3, Mpk4
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
Or1e28
Name: olfactory receptor family 1 subfamily E member 28
Synonyms: GA_x6K02T2P1NL-3884648-3883708, MOR135-22, Or1e28-ps1, Olfr388-ps1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258182
Ighv5-8
Name: immunoglobulin heavy variable V5-8
Synonyms: Gm17309
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 777782
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 16,374,709 bp
  • T to A, chromosome 1 at 28,777,349 bp
  • A to G, chromosome 1 at 105,750,403 bp
  • T to A, chromosome 2 at 69,469,387 bp
  • A to T, chromosome 2 at 119,179,413 bp
  • T to C, chromosome 3 at 96,221,299 bp
  • C to A, chromosome 4 at 43,177,421 bp
  • A to T, chromosome 4 at 98,638,721 bp
  • A to G, chromosome 4 at 149,331,476 bp
  • A to G, chromosome 4 at 149,626,107 bp
  • T to C, chromosome 5 at 4,086,504 bp
  • A to G, chromosome 5 at 34,649,432 bp
  • A to T, chromosome 5 at 44,063,178 bp
  • G to A, chromosome 5 at 48,219,943 bp
  • T to C, chromosome 5 at 100,381,288 bp
  • T to C, chromosome 5 at 121,378,535 bp
  • A to T, chromosome 5 at 129,657,827 bp
  • T to TCCC, chromosome 6 at 4,756,451 bp
  • T to C, chromosome 6 at 56,873,404 bp
  • T to C, chromosome 6 at 76,919,956 bp
  • A to G, chromosome 6 at 84,194,397 bp
  • T to C, chromosome 6 at 92,067,603 bp
  • T to C, chromosome 6 at 141,815,573 bp
  • T to C, chromosome 7 at 6,961,637 bp
  • C to T, chromosome 7 at 43,938,366 bp
  • G to A, chromosome 7 at 45,337,375 bp
  • A to T, chromosome 7 at 56,206,602 bp
  • G to A, chromosome 7 at 99,268,728 bp
  • G to T, chromosome 7 at 127,297,617 bp
  • A to G, chromosome 7 at 127,912,691 bp
  • G to A, chromosome 8 at 25,900,046 bp
  • G to T, chromosome 9 at 119,341,124 bp
  • A to C, chromosome 10 at 62,840,286 bp
  • C to A, chromosome 11 at 55,278,937 bp
  • T to A, chromosome 11 at 73,724,908 bp
  • T to C, chromosome 11 at 76,258,734 bp
  • C to T, chromosome 11 at 76,808,823 bp
  • T to C, chromosome 11 at 86,486,175 bp
  • T to A, chromosome 11 at 94,506,383 bp
  • A to T, chromosome 11 at 102,843,416 bp
  • T to C, chromosome 12 at 80,489,462 bp
  • T to A, chromosome 12 at 98,637,594 bp
  • A to G, chromosome 12 at 103,896,069 bp
  • T to A, chromosome 12 at 113,655,061 bp
  • A to T, chromosome 13 at 3,933,050 bp
  • A to G, chromosome 15 at 44,520,756 bp
  • G to A, chromosome 16 at 13,122,109 bp
  • A to T, chromosome 16 at 17,097,434 bp
  • T to C, chromosome 17 at 6,733,072 bp
  • A to T, chromosome 17 at 23,291,553 bp
  • A to G, chromosome 17 at 34,333,517 bp
  • A to G, chromosome 17 at 67,769,602 bp
  • T to A, chromosome 18 at 4,675,820 bp
  • A to G, chromosome 18 at 61,697,592 bp
  • T to A, chromosome 19 at 50,232,315 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9173 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068947-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.