Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9173Btlr/Mmmh
Stock Number:
068947-MU
Citation ID:
RRID:MMRRC_068947-MU
Other Names:
R9173 (G1)
Major Collection:

Strain Information

Tet1
Name: tet methylcytosine dioxygenase 1
Synonyms: 2510010B09Rik, D10Ertd17e, Cxxc6, BB001228
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52463
Homologene: 12735
Lrp2
Name: low density lipoprotein receptor-related protein 2
Synonyms: Megalin, Gp330, D230004K18Rik, b2b1625.2Clo
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14725
HGNC: HGNC:6694
Homologene: 20952
Ppil2
Name: peptidylprolyl isomerase (cyclophilin)-like 2
Synonyms: C130078A06Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66053
HGNC: HGNC:9261
Homologene: 8643
Fkbp9
Name: FK506 binding protein 9
Synonyms: FKBP60, FKBP63
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27055
HGNC: HGNC:3725
Homologene: 31434
Dnajc17
Name: DnaJ heat shock protein family (Hsp40) member C17
Synonyms: D9Bwg1371e, 1700025B16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69408
Homologene: 49527
Kat8
Name: K(lysine) acetyltransferase 8
Synonyms: D7Ertd629e, 5830450F21Rik, 2010203C02Rik, MOF, Myst1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67773
Homologene: 41676
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 16,374,709 bp
  • T to A, chromosome 1 at 28,777,349 bp
  • A to G, chromosome 1 at 105,750,403 bp
  • T to A, chromosome 2 at 69,469,387 bp
  • A to T, chromosome 2 at 119,179,413 bp
  • T to C, chromosome 3 at 96,221,299 bp
  • C to A, chromosome 4 at 43,177,421 bp
  • A to T, chromosome 4 at 98,638,721 bp
  • A to G, chromosome 4 at 149,331,476 bp
  • A to G, chromosome 4 at 149,626,107 bp
  • T to C, chromosome 5 at 4,086,504 bp
  • A to G, chromosome 5 at 34,649,432 bp
  • A to T, chromosome 5 at 44,063,178 bp
  • G to A, chromosome 5 at 48,219,943 bp
  • T to C, chromosome 5 at 100,381,288 bp
  • T to C, chromosome 5 at 121,378,535 bp
  • A to T, chromosome 5 at 129,657,827 bp
  • T to TCCC, chromosome 6 at 4,756,451 bp
  • T to C, chromosome 6 at 56,873,404 bp
  • T to C, chromosome 6 at 76,919,956 bp
  • A to G, chromosome 6 at 84,194,397 bp
  • T to C, chromosome 6 at 92,067,603 bp
  • T to C, chromosome 6 at 141,815,573 bp
  • T to C, chromosome 7 at 6,961,637 bp
  • C to T, chromosome 7 at 43,938,366 bp
  • G to A, chromosome 7 at 45,337,375 bp
  • A to T, chromosome 7 at 56,206,602 bp
  • G to A, chromosome 7 at 99,268,728 bp
  • G to T, chromosome 7 at 127,297,617 bp
  • A to G, chromosome 7 at 127,912,691 bp
  • G to A, chromosome 8 at 25,900,046 bp
  • G to T, chromosome 9 at 119,341,124 bp
  • A to C, chromosome 10 at 62,840,286 bp
  • C to A, chromosome 11 at 55,278,937 bp
  • T to A, chromosome 11 at 73,724,908 bp
  • T to C, chromosome 11 at 76,258,734 bp
  • C to T, chromosome 11 at 76,808,823 bp
  • T to C, chromosome 11 at 86,486,175 bp
  • T to A, chromosome 11 at 94,506,383 bp
  • A to T, chromosome 11 at 102,843,416 bp
  • T to C, chromosome 12 at 80,489,462 bp
  • T to A, chromosome 12 at 98,637,594 bp
  • A to G, chromosome 12 at 103,896,069 bp
  • T to A, chromosome 12 at 113,655,061 bp
  • A to T, chromosome 13 at 3,933,050 bp
  • A to G, chromosome 15 at 44,520,756 bp
  • G to A, chromosome 16 at 13,122,109 bp
  • A to T, chromosome 16 at 17,097,434 bp
  • T to C, chromosome 17 at 6,733,072 bp
  • A to T, chromosome 17 at 23,291,553 bp
  • A to G, chromosome 17 at 34,333,517 bp
  • A to G, chromosome 17 at 67,769,602 bp
  • T to A, chromosome 18 at 4,675,820 bp
  • A to G, chromosome 18 at 61,697,592 bp
  • T to A, chromosome 19 at 50,232,315 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9173 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068947-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.