Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9140Btlr/Mmmh
Stock Number:
068972-MU
Citation ID:
RRID:MMRRC_068972-MU
Other Names:
R9140 (G1)
Major Collection:

Strain Information

Chrnb4
Name: cholinergic receptor, nicotinic, beta polypeptide 4
Synonyms: Acrb-4, Acrb4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108015
VEGA: 9
HGNC: HGNC:1964
Homologene: 20196
Rgs16
Name: regulator of G-protein signaling 16
Synonyms: Rgsr
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19734
HGNC: HGNC:9997
Homologene: 2196
P2rx7
Name: purinergic receptor P2X, ligand-gated ion channel, 7
Synonyms: P2X7 receptor, P2X7R, P2X(7)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18439
HGNC: HGNC:8537
Homologene: 1925
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Manba
Name: mannosidase, beta A, lysosomal
Synonyms: Bmn, 2410030O07Rik, B930014J03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110173
HGNC: HGNC:6831
Homologene: 4317
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Dnttip1
Name: deoxynucleotidyltransferase, terminal, interacting protein 1
Synonyms: 6430706C13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76233
Homologene: 14189
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 36,420,966 bp
  • T to A, chromosome 1 at 135,840,897 bp
  • T to A, chromosome 1 at 153,743,635 bp
  • T to C, chromosome 1 at 166,388,608 bp
  • T to A, chromosome 2 at 20,881,214 bp
  • T to A, chromosome 2 at 24,635,212 bp
  • T to C, chromosome 2 at 60,441,111 bp
  • A to G, chromosome 2 at 76,943,896 bp
  • A to G, chromosome 2 at 90,745,733 bp
  • A to G, chromosome 2 at 164,754,162 bp
  • T to C, chromosome 2 at 165,767,057 bp
  • A to T, chromosome 3 at 64,090,044 bp
  • A to T, chromosome 3 at 73,050,459 bp
  • G to T, chromosome 3 at 92,825,151 bp
  • T to A, chromosome 3 at 93,396,138 bp
  • G to A, chromosome 3 at 135,485,729 bp
  • T to C, chromosome 4 at 8,183,270 bp
  • C to A, chromosome 4 at 11,610,386 bp
  • T to C, chromosome 4 at 19,819,487 bp
  • C to T, chromosome 4 at 106,748,147 bp
  • G to T, chromosome 4 at 115,007,252 bp
  • A to T, chromosome 4 at 123,474,062 bp
  • C to A, chromosome 4 at 126,443,184 bp
  • A to G, chromosome 4 at 132,701,100 bp
  • A to C, chromosome 4 at 136,896,242 bp
  • T to C, chromosome 5 at 9,399,226 bp
  • T to C, chromosome 5 at 32,152,698 bp
  • A to T, chromosome 5 at 112,354,857 bp
  • G to A, chromosome 5 at 122,652,726 bp
  • G to C, chromosome 5 at 145,469,624 bp
  • G to T, chromosome 5 at 149,213,480 bp
  • G to T, chromosome 5 at 151,644,676 bp
  • A to G, chromosome 6 at 124,192,248 bp
  • A to T, chromosome 7 at 4,149,658 bp
  • T to A, chromosome 7 at 10,158,716 bp
  • T to C, chromosome 7 at 25,285,740 bp
  • TCCCAGG to T, chromosome 7 at 80,098,331 bp
  • A to G, chromosome 7 at 104,004,115 bp
  • A to G, chromosome 7 at 112,407,619 bp
  • A to G, chromosome 8 at 22,780,546 bp
  • C to T, chromosome 9 at 21,276,138 bp
  • C to T, chromosome 9 at 35,013,300 bp
  • G to T, chromosome 9 at 36,120,686 bp
  • G to A, chromosome 9 at 55,034,671 bp
  • A to G, chromosome 9 at 72,945,706 bp
  • A to G, chromosome 9 at 85,735,061 bp
  • A to G, chromosome 10 at 7,638,914 bp
  • G to A, chromosome 10 at 10,340,519 bp
  • A to T, chromosome 10 at 77,776,848 bp
  • A to G, chromosome 10 at 80,671,593 bp
  • A to C, chromosome 10 at 127,856,961 bp
  • A to G, chromosome 11 at 23,672,625 bp
  • G to A, chromosome 11 at 67,209,263 bp
  • A to G, chromosome 11 at 72,399,967 bp
  • C to A, chromosome 11 at 100,257,650 bp
  • C to T, chromosome 11 at 100,379,565 bp
  • T to C, chromosome 12 at 98,207,414 bp
  • G to A, chromosome 13 at 3,588,441 bp
  • C to T, chromosome 13 at 67,540,954 bp
  • A to C, chromosome 14 at 45,657,461 bp
  • A to G, chromosome 14 at 101,198,994 bp
  • G to A, chromosome 15 at 66,919,308 bp
  • C to A, chromosome 16 at 48,872,925 bp
  • T to C, chromosome 16 at 57,270,119 bp
  • T to C, chromosome 17 at 25,125,206 bp
  • A to T, chromosome 17 at 33,433,196 bp
  • T to A, chromosome 18 at 19,989,559 bp
  • T to C, chromosome 18 at 47,281,942 bp
  • C to T, chromosome 18 at 80,440,828 bp
  • A to G, chromosome 19 at 56,319,502 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9140 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068972-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.