Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9140Btlr/Mmmh
Stock Number:
068972-MU
Citation ID:
RRID:MMRRC_068972-MU
Other Names:
R9140 (G1)
Major Collection:

Strain Information

Chrnb4
Name: cholinergic receptor, nicotinic, beta polypeptide 4
Synonyms: Acrb-4, Acrb4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108015
VEGA: 9
HGNC: HGNC:1964
Homologene: 20196
Rgs16
Name: regulator of G-protein signaling 16
Synonyms: Rgsr
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19734
HGNC: HGNC:9997
Homologene: 2196
P2rx7
Name: purinergic receptor P2X, ligand-gated ion channel, 7
Synonyms: P2X7 receptor, P2X7R, P2X(7)
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18439
HGNC: HGNC:8537
Homologene: 1925
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Manba
Name: mannosidase, beta A, lysosomal
Synonyms: Bmn, 2410030O07Rik, B930014J03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 110173
HGNC: HGNC:6831
Homologene: 4317
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Dnttip1
Name: deoxynucleotidyltransferase, terminal, interacting protein 1
Synonyms: 6430706C13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76233
Homologene: 14189
Fnbp4
Name: formin binding protein 4
Synonyms: FBP30
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 55935
Homologene: 9087
Ago1
Name: argonaute RISC catalytic subunit 1
Synonyms: argonaute 1, Eif2c1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 236511
HGNC: HGNC:3262
Homologene: 81826
Ctdp1
Name: CTD phosphatase subunit 1
Synonyms: 4930563P03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67655
HGNC: HGNC:2498
Homologene: 31254
Smtnl2
Name: smoothelin-like 2
Synonyms: D130058I21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276829
Homologene: 82367
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Pus10
Name: pseudouridylate synthase 10
Synonyms: 2810013G11Rik, 4933435A13Rik, Ccdc139
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74467
Homologene: 12566
Cic
Name: capicua transcriptional repressor
Synonyms: 1200010B10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71722
Homologene: 87637
Pygo1
Name: pygopus 1
Synonyms: 2600014C22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72135
Homologene: 41050
Eya3
Name: EYA transcriptional coactivator and phosphatase 3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14050
HGNC: HGNC:3521
Homologene: 1508
Sema6a
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A
Synonyms: VIa, sema, Sema6A-1, Semaq, A730020P05Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 20358
Homologene: 32426
Jup
Name: junction plakoglobin
Synonyms: PG, plakoglobin, gamma-catenin, D930025P04Rik, Ctnng
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16480
HGNC: HGNC:6207
Homologene: 1680
Slitrk3
Name: SLIT and NTRK-like family, member 3
Synonyms: ST3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 386750
Homologene: 8955
Fam151a
Name: family with sequence simliarity 151, member A
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230579
Homologene: 17143
Kirrel3
Name: kirre like nephrin family adhesion molecule 3
Synonyms: Neph2, 1500010O20Rik, 2900036G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67703
Homologene: 57050
Pcmt1
Name: protein-L-isoaspartate (D-aspartate) O-methyltransferase 1
Synonyms: protein carboxyl methyltransferase, PIMT
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18537
HGNC: HGNC:8728
Homologene: 135759
Zfp748
Name: zinc finger protein 748
Synonyms: 2610014M12Rik, mszf54, KRAB-O, Zfp208
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212276
Homologene: 134552
Ibtk
Name: inhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms: 5430411K16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108837
Homologene: 34661
Rad54b
Name: RAD54 homolog B (S. cerevisiae)
Synonyms: E130016E03Rik, E130016E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 623474
Homologene: 8240
Idh2
Name: isocitrate dehydrogenase 2 (NADP+), mitochondrial
Synonyms: Idh-2, IDPm
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269951
HGNC: HGNC:5383
Homologene: 37590
Ccn4
Name: cellular communication network factor 4
Synonyms: Elm1, CCN4, Wisp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22402
Homologene: 2883
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Rdh19
Name: retinol dehydrogenase 19
Synonyms: RDH-S, Rdhs
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216453
Homologene: 129514
Uspl1
Name: ubiquitin specific peptidase like 1
Synonyms: E430026A01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231915
Homologene: 4235
Vmn2r1
Name: vomeronasal 2, receptor 1
Synonyms: V2r83, EG56544
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56544
Homologene: 84832
Ddhd1
Name: DDHD domain containing 1
Synonyms: 9630061G18Rik, 4921528E07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 114874
Homologene: 35221
Myh1
Name: myosin, heavy polypeptide 1, skeletal muscle, adult
Synonyms: MyHC-IId/x, Myhs-f2, Myhs-f, Myhsf2, A530084A17Rik, MYHC-IIX, myosin heavy chain 2X, IId, IId/x
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17879
HGNC: HGNC:7567
Homologene: 133718
Eya2
Name: EYA transcriptional coactivator and phosphatase 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14049
HGNC: HGNC:3520
Homologene: 40711
Stil
Name: Scl/Tal1 interrupting locus
Synonyms: Sil
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20460
Homologene: 2283
Cacna1b
Name: calcium channel, voltage-dependent, N type, alpha 1B subunit
Synonyms: Cchn1a, alpha(1B), Cav2.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12287
HGNC: HGNC:1389
Homologene: 20184
Kprp
Name: keratinocyte expressed, proline-rich
Synonyms: 1110001M24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433619
Homologene: 54921
Elapor2
Name: endosome-lysosome associated apoptosis and autophagy regulator family member 2
Synonyms: 9330182L06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231014
Homologene: 27396
Adgb
Name: androglobin
Synonyms: 9130014G24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215772
Homologene: 100289
Micalcl
Name: MICAL C-terminal like
Synonyms: 4921517J23Rik, Ebitein1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100504195
Homologene: 13149
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: PLA2-I receptor, M-type receptor, Pla2g1br
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
C1qa
Name: complement component 1, q subcomponent, alpha polypeptide
Synonyms: C1q
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12259
HGNC: HGNC:1241
Homologene: 7249
Or51q1c
Name: olfactory receptor family 51 subfamily Q member 1C
Synonyms: GA_x6K02T2PBJ9-6737723-6738670, MOR5-1, Olfr638
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259124
Homologene: 133592
Vmn2r27
Name: vomeronasal 2, receptor27
Synonyms: EG232367
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232367
Rfc3
Name: replication factor C (activator 1) 3
Synonyms: 2810416I22Rik, 38kDa, 38kDa, Recc3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69263
HGNC: HGNC:9971
Homologene: 2188
Dsc3
Name: desmocollin 3
Synonyms: 5430426I24Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13507
VEGA: 18
HGNC: HGNC:3037
Homologene: 1462
Slc7a13
Name: solute carrier family 7, (cationic amino acid transporter, y+ system) member 13
Synonyms: XAT2, AGT1, AGT-1, 0610009O04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74087
Homologene: 23656
Vmn2r52
Name: vomeronasal 2, receptor 52
Synonyms: EG384534
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384534
Homologene: 129605
Krt17
Name: keratin 17
Synonyms: K17, Krt1-17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16667
HGNC: HGNC:6427
Homologene: 363
Galc
Name: galactosylceramidase
Synonyms: Gacy, 2310068B06Rik, galactocerebrosidase, A930008M05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14420
VEGA: 12
HGNC: HGNC:4115
Homologene: 124
Cyp3a16
Name: cytochrome P450, family 3, subfamily a, polypeptide 16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13114
HGNC: HGNC:2638
Homologene: 133568
Habp2
Name: hyaluronic acid binding protein 2
Synonyms: FSAP
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226243
HGNC: HGNC:4798
Homologene: 3050
Ccdc121rt3
Name: coiled-coil domain containing 121, retrogene 3
Synonyms: Gm6583
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 625424
Homologene: 116059
Actl9
Name: actin-like 9
Synonyms: 1700029I08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69481
Homologene: 77642
Ptx4
Name: pentraxin 4
Synonyms: 1110018H23Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68509
VEGA: 17
Homologene: 19179
Mknk2
Name: MAP kinase-interacting serine/threonine kinase 2
Synonyms: Mnk2, 2010016G11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17347
HGNC: HGNC:7111
Homologene: 49674
Tmem30c
Name: transmembrane protein 30C
Synonyms: 4933409A18Rik, 4933401B01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71027
Homologene: 78138
Car8
Name: carbonic anhydrase 8
Synonyms: Carp, Cals1, CA-RP VIII, wdl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12319
HGNC: HGNC:1382
Homologene: 20861
Tnnt2
Name: troponin T2, cardiac
Synonyms: Tnt, cTnT, cardiac TnT
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21956
Homologene: 68050
Plat
Name: plasminogen activator, tissue
Synonyms: t-PA, tPA, D8Ertd2e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18791
HGNC: HGNC:9051
Homologene: 717
Tada1
Name: transcriptional adaptor 1
Synonyms: 2900026B15Rik, Tada1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27878
Homologene: 41793
Prr30
Name: proline rich 30
Synonyms: 1700110M21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76627
Homologene: 130773
Retnlg
Name: resistin like gamma
Synonyms: Fizz3, Relmg, Xcp1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 245195
VEGA: 16
Homologene: 138458
Fosl2
Name: fos-like antigen 2
Synonyms: Fra-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14284
HGNC: HGNC:3798
Homologene: 3845
Leng9
Name: leukocyte receptor cluster (LRC) member 9
Synonyms: 9530024C23Rik, F630035L11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243813
Homologene: 18466
Dusp9
Name: dual specificity phosphatase 9
Synonyms: Pyst3, Mpk4
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 75590
HGNC: HGNC:3076
Homologene: 1066
Fer1l5
Name: fer-1 like family member 5
Synonyms: 4930533C12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100534273
Homologene: 85232
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 36,420,966 bp
  • T to A, chromosome 1 at 135,840,897 bp
  • T to A, chromosome 1 at 153,743,635 bp
  • T to C, chromosome 1 at 166,388,608 bp
  • T to A, chromosome 2 at 20,881,214 bp
  • T to A, chromosome 2 at 24,635,212 bp
  • T to C, chromosome 2 at 60,441,111 bp
  • A to G, chromosome 2 at 76,943,896 bp
  • A to G, chromosome 2 at 90,745,733 bp
  • A to G, chromosome 2 at 164,754,162 bp
  • T to C, chromosome 2 at 165,767,057 bp
  • A to T, chromosome 3 at 64,090,044 bp
  • A to T, chromosome 3 at 73,050,459 bp
  • G to T, chromosome 3 at 92,825,151 bp
  • T to A, chromosome 3 at 93,396,138 bp
  • G to A, chromosome 3 at 135,485,729 bp
  • T to C, chromosome 4 at 8,183,270 bp
  • C to A, chromosome 4 at 11,610,386 bp
  • T to C, chromosome 4 at 19,819,487 bp
  • C to T, chromosome 4 at 106,748,147 bp
  • G to T, chromosome 4 at 115,007,252 bp
  • A to T, chromosome 4 at 123,474,062 bp
  • C to A, chromosome 4 at 126,443,184 bp
  • A to G, chromosome 4 at 132,701,100 bp
  • A to C, chromosome 4 at 136,896,242 bp
  • T to C, chromosome 5 at 9,399,226 bp
  • T to C, chromosome 5 at 32,152,698 bp
  • A to T, chromosome 5 at 112,354,857 bp
  • G to A, chromosome 5 at 122,652,726 bp
  • G to C, chromosome 5 at 145,469,624 bp
  • G to T, chromosome 5 at 149,213,480 bp
  • G to T, chromosome 5 at 151,644,676 bp
  • A to G, chromosome 6 at 124,192,248 bp
  • A to T, chromosome 7 at 4,149,658 bp
  • T to A, chromosome 7 at 10,158,716 bp
  • T to C, chromosome 7 at 25,285,740 bp
  • TCCCAGG to T, chromosome 7 at 80,098,331 bp
  • A to G, chromosome 7 at 104,004,115 bp
  • A to G, chromosome 7 at 112,407,619 bp
  • A to G, chromosome 8 at 22,780,546 bp
  • C to T, chromosome 9 at 21,276,138 bp
  • C to T, chromosome 9 at 35,013,300 bp
  • G to T, chromosome 9 at 36,120,686 bp
  • G to A, chromosome 9 at 55,034,671 bp
  • A to G, chromosome 9 at 72,945,706 bp
  • A to G, chromosome 9 at 85,735,061 bp
  • A to G, chromosome 10 at 7,638,914 bp
  • G to A, chromosome 10 at 10,340,519 bp
  • A to T, chromosome 10 at 77,776,848 bp
  • A to G, chromosome 10 at 80,671,593 bp
  • A to C, chromosome 10 at 127,856,961 bp
  • A to G, chromosome 11 at 23,672,625 bp
  • G to A, chromosome 11 at 67,209,263 bp
  • A to G, chromosome 11 at 72,399,967 bp
  • C to A, chromosome 11 at 100,257,650 bp
  • C to T, chromosome 11 at 100,379,565 bp
  • T to C, chromosome 12 at 98,207,414 bp
  • G to A, chromosome 13 at 3,588,441 bp
  • C to T, chromosome 13 at 67,540,954 bp
  • A to C, chromosome 14 at 45,657,461 bp
  • A to G, chromosome 14 at 101,198,994 bp
  • G to A, chromosome 15 at 66,919,308 bp
  • C to A, chromosome 16 at 48,872,925 bp
  • T to C, chromosome 16 at 57,270,119 bp
  • T to C, chromosome 17 at 25,125,206 bp
  • A to T, chromosome 17 at 33,433,196 bp
  • T to A, chromosome 18 at 19,989,559 bp
  • T to C, chromosome 18 at 47,281,942 bp
  • C to T, chromosome 18 at 80,440,828 bp
  • A to G, chromosome 19 at 56,319,502 bp
  • TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG, chromosome X at 73,640,611 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9140 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068972-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.