Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9227Btlr/Mmmh
Stock Number:
068984-MU
Citation ID:
RRID:MMRRC_068984-MU
Other Names:
R9227 (G1)
Major Collection:

Strain Information

Thy1
Name: thymus cell antigen 1, theta
Synonyms: CD90, Thy-1, Thy 1.2, Thy1.1, Thy-1.2, Thy1.2, T25
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21838
Homologene: 4580
Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72895
Homologene: 12485
Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Cacna1h
Name: calcium channel, voltage-dependent, T type, alpha 1H subunit
Synonyms: alpha13.2, Cav3.2, T-type Cav3.2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 58226
HGNC: HGNC:1395
Homologene: 56913
Col3a1
Name: collagen, type III, alpha 1
Synonyms: Col3a-1, Tsk-2, Tsk2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12825
HGNC: HGNC:2201
Homologene: 55433
Atp1a1
Name: ATPase, Na+/K+ transporting, alpha 1 polypeptide
Synonyms: Atpa-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11928
HGNC: HGNC:799
Homologene: 564
Fubp3
Name: far upstream element (FUSE) binding protein 3
Synonyms: FBP3, A330051M14Rik, Marta2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320267
HGNC: HGNC:4005
Homologene: 45954
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 45,343,978 bp
  • A to T, chromosome 1 at 63,647,452 bp
  • A to C, chromosome 1 at 91,387,215 bp
  • A to T, chromosome 1 at 130,422,882 bp
  • C to T, chromosome 1 at 167,308,563 bp
  • A to G, chromosome 1 at 180,106,073 bp
  • T to A, chromosome 1 at 185,455,194 bp
  • T to C, chromosome 2 at 4,608,033 bp
  • T to C, chromosome 2 at 20,855,658 bp
  • A to T, chromosome 2 at 25,680,095 bp
  • C to T, chromosome 2 at 26,398,604 bp
  • A to G, chromosome 2 at 31,612,552 bp
  • A to T, chromosome 2 at 105,001,360 bp
  • G to T, chromosome 2 at 125,080,648 bp
  • C to T, chromosome 2 at 155,970,122 bp
  • T to C, chromosome 2 at 173,276,169 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • G to A, chromosome 3 at 29,357,168 bp
  • A to T, chromosome 3 at 41,711,196 bp
  • A to T, chromosome 3 at 95,204,687 bp
  • A to T, chromosome 3 at 101,592,434 bp
  • C to T, chromosome 4 at 8,805,272 bp
  • T to A, chromosome 4 at 19,878,374 bp
  • T to C, chromosome 4 at 88,571,515 bp
  • T to C, chromosome 4 at 107,568,130 bp
  • G to T, chromosome 4 at 130,167,478 bp
  • A to T, chromosome 4 at 130,337,135 bp
  • A to C, chromosome 4 at 149,237,900 bp
  • A to G, chromosome 5 at 45,463,941 bp
  • T to C, chromosome 5 at 63,939,762 bp
  • T to C, chromosome 5 at 87,886,598 bp
  • G to A, chromosome 5 at 112,378,039 bp
  • A to T, chromosome 5 at 134,221,864 bp
  • A to G, chromosome 5 at 139,716,072 bp
  • G to T, chromosome 5 at 142,787,637 bp
  • G to A, chromosome 5 at 143,373,439 bp
  • T to A, chromosome 6 at 87,050,924 bp
  • C to A, chromosome 6 at 94,630,132 bp
  • T to C, chromosome 6 at 113,121,794 bp
  • C to T, chromosome 6 at 118,089,149 bp
  • T to C, chromosome 6 at 124,516,780 bp
  • T to C, chromosome 6 at 124,818,636 bp
  • C to T, chromosome 7 at 22,790,044 bp
  • T to C, chromosome 7 at 99,925,492 bp
  • C to T, chromosome 8 at 13,221,974 bp
  • T to C, chromosome 8 at 95,366,331 bp
  • C to T, chromosome 9 at 44,046,707 bp
  • A to G, chromosome 9 at 107,260,155 bp
  • T to C, chromosome 9 at 107,787,299 bp
  • T to C, chromosome 9 at 107,975,802 bp
  • T to A, chromosome 9 at 118,556,873 bp
  • A to T, chromosome 9 at 123,819,146 bp
  • C to T, chromosome 10 at 21,154,713 bp
  • T to C, chromosome 10 at 41,947,939 bp
  • A to T, chromosome 10 at 77,321,792 bp
  • G to A, chromosome 10 at 78,956,095 bp
  • A to G, chromosome 11 at 55,007,868 bp
  • T to A, chromosome 11 at 120,105,955 bp
  • A to T, chromosome 12 at 16,538,482 bp
  • T to C, chromosome 12 at 101,549,794 bp
  • C to A, chromosome 13 at 9,878,443 bp
  • T to G, chromosome 13 at 19,690,214 bp
  • TA to TAA, chromosome 13 at 102,705,006 bp
  • C to A, chromosome 13 at 119,712,582 bp
  • T to C, chromosome 14 at 26,923,735 bp
  • A to G, chromosome 14 at 55,785,846 bp
  • C to T, chromosome 14 at 56,564,719 bp
  • T to C, chromosome 15 at 71,464,007 bp
  • A to G, chromosome 15 at 99,636,197 bp
  • T to C, chromosome 15 at 99,955,503 bp
  • A to G, chromosome 16 at 17,980,937 bp
  • A to T, chromosome 16 at 38,534,806 bp
  • T to C, chromosome 17 at 25,380,882 bp
  • T to C, chromosome 17 at 28,775,558 bp
  • T to C, chromosome 17 at 33,576,450 bp
  • A to G, chromosome 17 at 71,750,222 bp
  • T to G, chromosome 17 at 87,719,289 bp
  • T to C, chromosome 18 at 36,741,666 bp
  • A to G, chromosome 18 at 36,998,901 bp
  • G to A, chromosome 19 at 11,760,384 bp
  • A to G, chromosome 19 at 34,647,836 bp
  • T to A, chromosome 19 at 41,104,997 bp
  • T to G, chromosome Y at 3,774,819 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9227 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068984-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.