Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9131Btlr/Mmmh
Stock Number:
069010-MU
Citation ID:
RRID:MMRRC_069010-MU
Other Names:
R9131 (G1)
Major Collection:

Strain Information

Dnmt3a
Name: DNA methyltransferase 3A
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13435
HGNC: HGNC:2978
Homologene: 7294
Shprh
Name: SNF2 histone linker PHD RING helicase
Synonyms: 2610103K11Rik, D230017O13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268281
Homologene: 6489
Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Camk2a
Name: calcium/calmodulin-dependent protein kinase II alpha
Synonyms: alpha-CaMKII
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12322
HGNC: HGNC:1460
Homologene: 56577
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 4930518N04Rik, neurabin-I, A230094E16Rik, 2810430P21Rik, Neurabin I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Arhgef18
Name: Rho/Rac guanine nucleotide exchange factor 18
Synonyms: D030053O22Rik, A430078G23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102098
Homologene: 32254
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 46,227,020 bp (GRCm38)
  • T to A, chromosome 1 at 65,246,080 bp (GRCm38)
  • T to C, chromosome 1 at 78,483,314 bp (GRCm38)
  • C to T, chromosome 1 at 100,050,643 bp (GRCm38)
  • T to A, chromosome 1 at 173,332,508 bp (GRCm38)
  • A to G, chromosome 2 at 25,458,313 bp (GRCm38)
  • A to T, chromosome 2 at 32,769,220 bp (GRCm38)
  • A to T, chromosome 2 at 37,414,690 bp (GRCm38)
  • G to A, chromosome 2 at 40,699,578 bp (GRCm38)
  • A to T, chromosome 2 at 82,982,826 bp (GRCm38)
  • T to C, chromosome 2 at 143,813,663 bp (GRCm38)
  • A to T, chromosome 2 at 167,050,378 bp (GRCm38)
  • T to C, chromosome 3 at 20,029,186 bp (GRCm38)
  • C to A, chromosome 3 at 92,738,096 bp (GRCm38)
  • C to A, chromosome 3 at 103,157,715 bp (GRCm38)
  • T to C, chromosome 4 at 8,785,642 bp (GRCm38)
  • T to A, chromosome 4 at 32,762,275 bp (GRCm38)
  • C to A, chromosome 4 at 53,694,756 bp (GRCm38)
  • T to A, chromosome 4 at 58,087,778 bp (GRCm38)
  • G to A, chromosome 4 at 126,030,020 bp (GRCm38)
  • T to A, chromosome 5 at 137,605,508 bp (GRCm38)
  • T to C, chromosome 5 at 137,810,920 bp (GRCm38)
  • T to C, chromosome 5 at 144,743,719 bp (GRCm38)
  • A to G, chromosome 6 at 5,134,106 bp (GRCm38)
  • A to G, chromosome 6 at 37,554,516 bp (GRCm38)
  • A to G, chromosome 6 at 66,553,036 bp (GRCm38)
  • G to A, chromosome 6 at 72,436,244 bp (GRCm38)
  • A to G, chromosome 6 at 116,493,920 bp (GRCm38)
  • A to G, chromosome 7 at 4,477,574 bp (GRCm38)
  • A to G, chromosome 7 at 17,098,099 bp (GRCm38)
  • A to G, chromosome 7 at 19,184,826 bp (GRCm38)
  • G to T, chromosome 7 at 20,787,417 bp (GRCm38)
  • A to G, chromosome 7 at 27,337,551 bp (GRCm38)
  • T to A, chromosome 7 at 46,303,173 bp (GRCm38)
  • A to G, chromosome 7 at 82,595,514 bp (GRCm38)
  • G to A, chromosome 7 at 88,309,808 bp (GRCm38)
  • G to A, chromosome 7 at 97,713,918 bp (GRCm38)
  • T to C, chromosome 7 at 102,887,979 bp (GRCm38)
  • C to A, chromosome 7 at 127,406,547 bp (GRCm38)
  • T to A, chromosome 7 at 135,679,146 bp (GRCm38)
  • T to C, chromosome 7 at 141,809,792 bp (GRCm38)
  • A to G, chromosome 7 at 145,260,925 bp (GRCm38)
  • G to A, chromosome 8 at 3,437,007 bp (GRCm38)
  • A to G, chromosome 8 at 41,354,012 bp (GRCm38)
  • A to T, chromosome 8 at 95,253,265 bp (GRCm38)
  • A to G, chromosome 8 at 126,953,178 bp (GRCm38)
  • A to G, chromosome 9 at 9,011,363 bp (GRCm38)
  • A to T, chromosome 9 at 53,533,744 bp (GRCm38)
  • G to C, chromosome 9 at 59,861,489 bp (GRCm38)
  • A to G, chromosome 9 at 65,001,004 bp (GRCm38)
  • A to T, chromosome 9 at 78,166,948 bp (GRCm38)
  • G to T, chromosome 9 at 103,211,888 bp (GRCm38)
  • A to G, chromosome 9 at 109,223,446 bp (GRCm38)
  • A to G, chromosome 9 at 110,135,642 bp (GRCm38)
  • T to A, chromosome 9 at 123,552,762 bp (GRCm38)
  • A to C, chromosome 9 at 123,636,998 bp (GRCm38)
  • T to C, chromosome 10 at 11,162,845 bp (GRCm38)
  • T to A, chromosome 10 at 24,904,381 bp (GRCm38)
  • A to T, chromosome 10 at 41,265,411 bp (GRCm38)
  • T to C, chromosome 10 at 59,435,929 bp (GRCm38)
  • C to A, chromosome 10 at 129,063,228 bp (GRCm38)
  • T to C, chromosome 11 at 68,492,273 bp (GRCm38)
  • A to T, chromosome 11 at 73,777,324 bp (GRCm38)
  • ACAGCAGCAGCAGCAGCAGCAGC to ACAGCAGCAGCAGCAGCAGC, chromosome 11 at 94,214,377 bp (GRCm38)
  • T to A, chromosome 11 at 101,076,905 bp (GRCm38)
  • T to C, chromosome 11 at 105,798,777 bp (GRCm38)
  • A to G, chromosome 11 at 114,928,308 bp (GRCm38)
  • T to A, chromosome 11 at 117,290,634 bp (GRCm38)
  • A to T, chromosome 12 at 3,866,136 bp (GRCm38)
  • A to G, chromosome 12 at 55,860,128 bp (GRCm38)
  • A to T, chromosome 12 at 98,858,840 bp (GRCm38)
  • A to C, chromosome 12 at 114,366,926 bp (GRCm38)
  • A to G, chromosome 13 at 27,606,985 bp (GRCm38)
  • T to C, chromosome 13 at 48,491,081 bp (GRCm38)
  • G to A, chromosome 13 at 60,761,394 bp (GRCm38)
  • A to T, chromosome 13 at 67,825,566 bp (GRCm38)
  • T to A, chromosome 14 at 33,097,850 bp (GRCm38)
  • A to G, chromosome 14 at 121,911,761 bp (GRCm38)
  • A to G, chromosome 15 at 74,983,157 bp (GRCm38)
  • T to A, chromosome 15 at 75,565,673 bp (GRCm38)
  • G to A, chromosome 15 at 100,681,157 bp (GRCm38)
  • G to T, chromosome 16 at 34,956,465 bp (GRCm38)
  • T to A, chromosome 16 at 62,928,034 bp (GRCm38)
  • A to G, chromosome 16 at 89,860,267 bp (GRCm38)
  • A to G, chromosome 17 at 18,325,881 bp (GRCm38)
  • A to C, chromosome 17 at 35,004,797 bp (GRCm38)
  • G to T, chromosome 17 at 42,667,367 bp (GRCm38)
  • C to T, chromosome 18 at 36,024,343 bp (GRCm38)
  • C to G, chromosome 18 at 49,939,572 bp (GRCm38)
  • C to T, chromosome 18 at 60,943,255 bp (GRCm38)
  • T to A, chromosome 19 at 13,027,996 bp (GRCm38)
  • C to A, chromosome 19 at 43,441,400 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9131 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069010-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.