Strain Name:
C57BL/6J-MtgxR9131Btlr/Mmmh
Stock Number:
069010-MU
Citation ID:
RRID:MMRRC_069010-MU
Other Names:
R9131 (G1)
Major Collection:

Strain Information

Dnmt3a
Name: DNA methyltransferase 3A
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13435
HGNC: HGNC:2978
Homologene: 7294
Shprh
Name: SNF2 histone linker PHD RING helicase
Synonyms: 2610103K11Rik, D230017O13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268281
Homologene: 6489
Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: Whi, GENA 60, GENA 47, Gena 52, Cyn, Cycn, Dz, WBE1, Edy, Flo, Lda, Mt, Obt, Todo, A730019I05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Camk2a
Name: calcium/calmodulin-dependent protein kinase II alpha
Synonyms: alpha-CaMKII
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12322
HGNC: HGNC:1460
Homologene: 56577
Ppp1r9a
Name: protein phosphatase 1, regulatory subunit 9A
Synonyms: 2810430P21Rik, A230094E16Rik, Neurabin I, 4930518N04Rik, neurabin-I, NRB
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243725
Homologene: 14247
Atm
Name: ataxia telangiectasia mutated
Synonyms: C030026E19Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11920
HGNC: HGNC:795
Homologene: 30952
Arhgef18
Name: Rho/Rac guanine nucleotide exchange factor 18
Synonyms: D030053O22Rik, A430078G23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102098
Homologene: 32254
Cilk1
Name: ciliogenesis associated kinase 1
Synonyms: 2210420N10Rik, Ick
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56542
Homologene: 69218
Ltbp4
Name: latent transforming growth factor beta binding protein 4
Synonyms: 2310046A13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108075
HGNC: HGNC:6717
Homologene: 2645
Zfp273
Name: zinc finger protein 273
Synonyms: 6820416H06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212569
Homologene: 133729
Mat2a
Name: methionine adenosyltransferase 2A
Synonyms: D630045P18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232087
HGNC: HGNC:6904
Homologene: 38112
Rc3h2
Name: ring finger and CCCH-type zinc finger domains 2
Synonyms: 2900024N03Rik, D930043C02Rik, 9430019J22Rik, Mnab, Rnf164
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319817
Homologene: 28276
Smarcc1
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1
Synonyms: msp3, SRG3, BAF155
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20588
Homologene: 68296
Znfx1
Name: zinc finger, NFX1-type containing 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98999
Homologene: 10877
Sacm1l
Name: SAC1 suppressor of actin mutations 1-like (yeast)
Synonyms: SAC1, Sac1p
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83493
VEGA: 9
Homologene: 6320
Dennd2c
Name: DENN domain containing 2C
Synonyms: A930010I20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329727
Homologene: 19542
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Tanc2
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms: 3526402J09Rik, 5730590C14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77097
Homologene: 64680
Mdn1
Name: midasin AAA ATPase 1
Synonyms: D4Abb1e, 4833432B22Rik, LOC213784
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
Tiam1
Name: T cell lymphoma invasion and metastasis 1
Synonyms: D16Ium10, D16Ium10e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21844
Homologene: 2443
Rbm34
Name: RNA binding motif protein 34
Synonyms: 4930547K05Rik, D8Ertd233e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52202
Homologene: 56691
Arhgap42
Name: Rho GTPase activating protein 42
Synonyms: 9030420J04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71544
Homologene: 28446
Vars1
Name: valyl-tRNA synthetase 1
Synonyms: Bat-6, Vars, D17H6S56E, Bat6, Vars2, G7a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22321
Homologene: 4587
Myo9a
Name: myosin IXa
Synonyms: 4732465J09Rik, C130068I12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270163
HGNC: HGNC:7608
Homologene: 21371
Pikfyve
Name: phosphoinositide kinase, FYVE type zinc finger containing
Synonyms: PipkIII, Pip5k3, 5230400C17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18711
Homologene: 32115
Ackr1
Name: atypical chemokine receptor 1 (Duffy blood group)
Synonyms: CCBP1, Dfy, Darc, FY, ESTM35, CD234
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13349
HGNC: HGNC:4035
Homologene: 48067
Trf
Name: transferrin
Synonyms: Tfn, HP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22041
Homologene: 68153
Brms1l
Name: breast cancer metastasis-suppressor 1-like
Synonyms: BRMS1, 0710008O11Rik, D12Ertd407e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52592
VEGA: 12
Homologene: 9123
Cd300lb
Name: CD300 molecule like family member B
Synonyms: LMIR5, LOC217304, CLM-7, Clm7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217304
Homologene: 18374
Oit3
Name: oncoprotein induced transcript 3
Synonyms: EF-9
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18302
Homologene: 7870
Ctsc
Name: cathepsin C
Synonyms: DPP1, dipeptidylpeptidase 1, DPPI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13032
HGNC: HGNC:2528
Homologene: 1373
Pros1
Name: protein S (alpha)
Synonyms: protein S
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19128
HGNC: HGNC:9456
Homologene: 264
Farsb
Name: phenylalanyl-tRNA synthetase, beta subunit
Synonyms: PheRS alpha, Farsl, Farslb, Frsb
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23874
Homologene: 4160
Tob1
Name: transducer of ErbB-2.1
Synonyms: Tob, Trob
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22057
Homologene: 31334
Septin9
Name: septin 9
Synonyms: Sint1, Msf, SL3-3 integration site 1, Sept9, PNUTL4, MSF1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53860
HGNC: HGNC:7323
Homologene: 90949
Hacd3
Name: 3-hydroxyacyl-CoA dehydratase 3
Synonyms: Ptplad1, B-ind1, Hspc121
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57874
VEGA: 9
Homologene: 9494
Zfp169
Name: zinc finger protein 169
Synonyms: 1700025J14Rik, 4930429A13Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67911
Homologene: 2572
Dapk1
Name: death associated protein kinase 1
Synonyms: DAP-Kinase, D13Ucla1, 2810425C21Rik, 2310039H24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69635
VEGA: 13
HGNC: HGNC:2674
Homologene: 3626
Med23
Name: mediator complex subunit 23
Synonyms: ESTM7, Sur2, Crsp3, X83317, sno, 3000002A17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70208
HGNC: HGNC:2372
Homologene: 3552
Eml2
Name: echinoderm microtubule associated protein like 2
Synonyms: 1600029N02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72205
Homologene: 8125
Tpcn2
Name: two pore segment channel 2
Synonyms: D830047E22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233979
Homologene: 16375
Eml5
Name: echinoderm microtubule associated protein like 5
Synonyms: C130068M19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319670
VEGA: 12
Homologene: 26807
Tmem130
Name: transmembrane protein 130
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243339
Homologene: 17680
Cngb1
Name: cyclic nucleotide gated channel beta 1
Synonyms: BC016201, Cngb1, Cngb1b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 333329
HGNC: HGNC:2151
Homologene: 136420
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Hps3
Name: HPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonyms: Hermansky-Pudlak syndrome 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12807
Homologene: 13019
Adgrf4
Name: adhesion G protein-coupled receptor F4
Synonyms: 4632435A09Rik, Gpr115
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78249
Homologene: 51953
Adamtsl3
Name: ADAMTS-like 3
Synonyms: punctin-2, 9230119C12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269959
Homologene: 18912
Fig4
Name: FIG4 phosphoinositide 5-phosphatase
Synonyms: A530089I17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103199
VEGA: 10
Homologene: 6713
Ttc16
Name: tetratricopeptide repeat domain 16
Synonyms: 1200002K10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 338348
Homologene: 17011
Pcsk2
Name: proprotein convertase subtilisin/kexin type 2
Synonyms: SPC2, prohormone convertase 2, 6330411F23Rik, Nec-2, Phpp-2, Nec2, PC2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18549
HGNC: HGNC:8744
Homologene: 37640
Svep1
Name: sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
Synonyms: 1110021D17Rik, Polydom, D430029O09Rik, 4833413O10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 64817
Homologene: 23386
Fsd1l
Name: fibronectin type III and SPRY domain containing 1-like
Synonyms: Fsd1nl, Csdufd1, A230072O16Rik, Ccdc10
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 319636
Homologene: 45825
Wdfy4
Name: WD repeat and FYVE domain containing 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 545030
Homologene: 83473
Eps8l1
Name: EPS8-like 1
Synonyms: EPS8R1, DRC3, 4632407K17Rik, 2310051G19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67425
Homologene: 15767
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Csf3r
Name: colony stimulating factor 3 receptor
Synonyms: Csfgr, Cd114, G-CSFR
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12986
HGNC: HGNC:2439
Homologene: 601
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Naglu
Name: alpha-N-acetylglucosaminidase (Sanfilippo disease IIIB)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27419
HGNC: HGNC:7632
Homologene: 222
Vmn2r93
Name: vomeronasal 2, receptor 93
Synonyms: EG627132
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627132
Homologene: 129750
Pik3r5
Name: phosphoinositide-3-kinase regulatory subunit 5
Synonyms: Foap2, p101
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320207
Homologene: 8627
Or1e29
Name: olfactory receptor family 1 subfamily E member 29
Synonyms: Olfr389, GA_x6K02T2P1NL-3932085-3931147, MOR135-6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259011
Homologene: 85925
Or5b101
Name: olfactory receptor family 5 subfamily B member 101
Synonyms: Olfr1453, GA_x6K02T2RE5P-3357666-3356743, MOR202-6
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258695
HGNC: HGNC:8324
Homologene: 120159
Zcwpw1
Name: zinc finger, CW type with PWWP domain 1
Synonyms: LOC381678
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381678
Homologene: 9944
Slc6a20a
Name: solute carrier family 6 (neurotransmitter transporter), member 20A
Synonyms: A730081N20Rik, Xtrp3s1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102680
Homologene: 10625
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: Dnahc7b, LOC227058
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Mylk
Name: myosin, light polypeptide kinase
Synonyms: telokin, nmMlck, Mlck, 9530072E15Rik, MLCK108, MLCK210, A930019C19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 107589
HGNC: HGNC:7590
Homologene: 14202
Pcolce
Name: procollagen C-endopeptidase enhancer protein
Synonyms: Astt2, Astt-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18542
HGNC: HGNC:8738
Homologene: 1946
Cntnap5b
Name: contactin associated protein-like 5B
Synonyms: Caspr5-2, C230078M14Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241175
Homologene: 104295
Nrg2
Name: neuregulin 2
Synonyms: NTAK, Don1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 100042150
HGNC: HGNC:7998
Homologene: 75024
Ptpre
Name: protein tyrosine phosphatase receptor type E
Synonyms: PTPepsilon, PTPe, RPTPepsilon
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19267
HGNC: HGNC:9669
Homologene: 31387
Akr1d1
Name: aldo-keto reductase family 1, member D1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 208665
HGNC: HGNC:388
Homologene: 55943
Clns1a
Name: chloride channel, nucleotide-sensitive, 1A
Synonyms: ICLN, 2610036D06Rik, Clcni, 2610100O04Rik, Clci
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12729
HGNC: HGNC:2080
Homologene: 990
Vmn1r113
Name: vomeronasal 1 receptor 113
Synonyms: Gm5748
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 436135
Homologene: 104166
Cnnm1
Name: cyclin M1
Synonyms: Acdp1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83674
VEGA: 19
HGNC: HGNC:102
Homologene: 10673
Psg16
Name: pregnancy specific beta-1-glycoprotein 16
Synonyms: Cea11, bCEA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26436
Or52r1
Name: olfactory receptor family 52 subfamily R member 1
Synonyms: Olfr569, GA_x6K02T2PBJ9-5599295-5598351, MOR30-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259092
Homologene: 17500
Clic3
Name: chloride intracellular channel 3
Synonyms: 2300003G24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69454
HGNC: HGNC:2064
Homologene: 3432
Zfp764
Name: zinc finger protein 764
Synonyms: 8030466O12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233893
Homologene: 62158
Asah1
Name: N-acylsphingosine amidohydrolase 1
Synonyms: 2310081N20Rik, acid ceramidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11886
HGNC: HGNC:735
Homologene: 10504
Fbxw20
Name: F-box and WD-40 domain protein 20
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 434440
Homologene: 110776
Vmn1r32
Name: vomeronasal 1 receptor 32
Synonyms: V1rc15
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171188
Homologene: 115644
Or13a1
Name: olfactory receptor family 13 subfamily A member 1
Synonyms: Olfr211, GA_x54KRFPKN04-58127726-58128655, MOR253-9
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258914
Homologene: 17434
Ly6h
Name: lymphocyte antigen 6 family member H
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 23934
HGNC: HGNC:6728
Homologene: 1758
Ly6i
Name: lymphocyte antigen 6 family member I
Synonyms: Ly-6I, Ly-6M
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 57248
Homologene: 113718
Prl7b1
Name: prolactin family 7, subfamily b, member 1
Synonyms: Prlpn, 1600014J19Rik, PLP-N
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75596
Homologene: 17809
Gpr18
Name: G protein-coupled receptor 18
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110168
VEGA: 14
HGNC: HGNC:4472
Homologene: 18814
Cela1
Name: chymotrypsin-like elastase family, member 1
Synonyms: Ela1, 1810062B19Rik, PC-TsF, Ela-1, 1810009A17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 109901
VEGA: 15
HGNC: HGNC:3308
Homologene: 20454
Gm38119
Name: predicted gene, 38119
Type: Gene
Species: Mouse
Chromosome: 3
Or6c63-ps1
Name: olfactory receptor family 6 subfamily C member 63, pseudogene 1
Synonyms: EG544748, GA_x6K02T2PULF-10749079-10748573, EG546487, Olfr766, Olfr766-ps1, MOR115-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 546487
Homologene: 67771
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 46,227,020 bp (GRCm38)
  • T to A, chromosome 1 at 65,246,080 bp (GRCm38)
  • T to C, chromosome 1 at 78,483,314 bp (GRCm38)
  • C to T, chromosome 1 at 100,050,643 bp (GRCm38)
  • T to A, chromosome 1 at 173,332,508 bp (GRCm38)
  • A to G, chromosome 2 at 25,458,313 bp (GRCm38)
  • A to T, chromosome 2 at 32,769,220 bp (GRCm38)
  • A to T, chromosome 2 at 37,414,690 bp (GRCm38)
  • G to A, chromosome 2 at 40,699,578 bp (GRCm38)
  • A to T, chromosome 2 at 82,982,826 bp (GRCm38)
  • T to C, chromosome 2 at 143,813,663 bp (GRCm38)
  • A to T, chromosome 2 at 167,050,378 bp (GRCm38)
  • T to C, chromosome 3 at 20,029,186 bp (GRCm38)
  • C to A, chromosome 3 at 92,738,096 bp (GRCm38)
  • C to A, chromosome 3 at 103,157,715 bp (GRCm38)
  • T to C, chromosome 4 at 8,785,642 bp (GRCm38)
  • T to A, chromosome 4 at 32,762,275 bp (GRCm38)
  • C to A, chromosome 4 at 53,694,756 bp (GRCm38)
  • T to A, chromosome 4 at 58,087,778 bp (GRCm38)
  • G to A, chromosome 4 at 126,030,020 bp (GRCm38)
  • T to A, chromosome 5 at 137,605,508 bp (GRCm38)
  • T to C, chromosome 5 at 137,810,920 bp (GRCm38)
  • T to C, chromosome 5 at 144,743,719 bp (GRCm38)
  • A to G, chromosome 6 at 5,134,106 bp (GRCm38)
  • A to G, chromosome 6 at 37,554,516 bp (GRCm38)
  • A to G, chromosome 6 at 66,553,036 bp (GRCm38)
  • G to A, chromosome 6 at 72,436,244 bp (GRCm38)
  • A to G, chromosome 6 at 116,493,920 bp (GRCm38)
  • A to G, chromosome 7 at 4,477,574 bp (GRCm38)
  • A to G, chromosome 7 at 17,098,099 bp (GRCm38)
  • A to G, chromosome 7 at 19,184,826 bp (GRCm38)
  • G to T, chromosome 7 at 20,787,417 bp (GRCm38)
  • A to G, chromosome 7 at 27,337,551 bp (GRCm38)
  • T to A, chromosome 7 at 46,303,173 bp (GRCm38)
  • A to G, chromosome 7 at 82,595,514 bp (GRCm38)
  • G to A, chromosome 7 at 88,309,808 bp (GRCm38)
  • G to A, chromosome 7 at 97,713,918 bp (GRCm38)
  • T to C, chromosome 7 at 102,887,979 bp (GRCm38)
  • C to A, chromosome 7 at 127,406,547 bp (GRCm38)
  • T to A, chromosome 7 at 135,679,146 bp (GRCm38)
  • T to C, chromosome 7 at 141,809,792 bp (GRCm38)
  • A to G, chromosome 7 at 145,260,925 bp (GRCm38)
  • G to A, chromosome 8 at 3,437,007 bp (GRCm38)
  • A to G, chromosome 8 at 41,354,012 bp (GRCm38)
  • A to T, chromosome 8 at 95,253,265 bp (GRCm38)
  • A to G, chromosome 8 at 126,953,178 bp (GRCm38)
  • A to G, chromosome 9 at 9,011,363 bp (GRCm38)
  • A to T, chromosome 9 at 53,533,744 bp (GRCm38)
  • G to C, chromosome 9 at 59,861,489 bp (GRCm38)
  • A to G, chromosome 9 at 65,001,004 bp (GRCm38)
  • A to T, chromosome 9 at 78,166,948 bp (GRCm38)
  • G to T, chromosome 9 at 103,211,888 bp (GRCm38)
  • A to G, chromosome 9 at 109,223,446 bp (GRCm38)
  • A to G, chromosome 9 at 110,135,642 bp (GRCm38)
  • T to A, chromosome 9 at 123,552,762 bp (GRCm38)
  • A to C, chromosome 9 at 123,636,998 bp (GRCm38)
  • T to C, chromosome 10 at 11,162,845 bp (GRCm38)
  • T to A, chromosome 10 at 24,904,381 bp (GRCm38)
  • A to T, chromosome 10 at 41,265,411 bp (GRCm38)
  • T to C, chromosome 10 at 59,435,929 bp (GRCm38)
  • C to A, chromosome 10 at 129,063,228 bp (GRCm38)
  • T to C, chromosome 11 at 68,492,273 bp (GRCm38)
  • A to T, chromosome 11 at 73,777,324 bp (GRCm38)
  • ACAGCAGCAGCAGCAGCAGCAGC to ACAGCAGCAGCAGCAGCAGC, chromosome 11 at 94,214,377 bp (GRCm38)
  • T to A, chromosome 11 at 101,076,905 bp (GRCm38)
  • T to C, chromosome 11 at 105,798,777 bp (GRCm38)
  • A to G, chromosome 11 at 114,928,308 bp (GRCm38)
  • T to A, chromosome 11 at 117,290,634 bp (GRCm38)
  • A to T, chromosome 12 at 3,866,136 bp (GRCm38)
  • A to G, chromosome 12 at 55,860,128 bp (GRCm38)
  • A to T, chromosome 12 at 98,858,840 bp (GRCm38)
  • A to C, chromosome 12 at 114,366,926 bp (GRCm38)
  • A to G, chromosome 13 at 27,606,985 bp (GRCm38)
  • T to C, chromosome 13 at 48,491,081 bp (GRCm38)
  • G to A, chromosome 13 at 60,761,394 bp (GRCm38)
  • A to T, chromosome 13 at 67,825,566 bp (GRCm38)
  • T to A, chromosome 14 at 33,097,850 bp (GRCm38)
  • A to G, chromosome 14 at 121,911,761 bp (GRCm38)
  • A to G, chromosome 15 at 74,983,157 bp (GRCm38)
  • T to A, chromosome 15 at 75,565,673 bp (GRCm38)
  • G to A, chromosome 15 at 100,681,157 bp (GRCm38)
  • G to T, chromosome 16 at 34,956,465 bp (GRCm38)
  • T to A, chromosome 16 at 62,928,034 bp (GRCm38)
  • A to G, chromosome 16 at 89,860,267 bp (GRCm38)
  • A to G, chromosome 17 at 18,325,881 bp (GRCm38)
  • A to C, chromosome 17 at 35,004,797 bp (GRCm38)
  • G to T, chromosome 17 at 42,667,367 bp (GRCm38)
  • C to T, chromosome 18 at 36,024,343 bp (GRCm38)
  • C to G, chromosome 18 at 49,939,572 bp (GRCm38)
  • C to T, chromosome 18 at 60,943,255 bp (GRCm38)
  • T to A, chromosome 19 at 13,027,996 bp (GRCm38)
  • C to A, chromosome 19 at 43,441,400 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9131 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069010-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.