Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9170Btlr/Mmmh
Stock Number:
069026-MU
Citation ID:
RRID:MMRRC_069026-MU
Other Names:
R9170 (G1)
Major Collection:

Strain Information

Rest
Name: RE1-silencing transcription factor
Synonyms: 2610008J04Rik, NRSF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19712
HGNC: HGNC:9966
Homologene: 4099
Chrna3
Name: cholinergic receptor, nicotinic, alpha polypeptide 3
Synonyms: (a)3, alpha 3, neuronal nicotinic acetylcholine receptor, alpha 3 subunit, Acra-3, Acra3, A730007P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110834
VEGA: 9
HGNC: HGNC:1957
Homologene: 591
Atp2a2
Name: ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Synonyms: sarco/endoplasmic reticulum Ca2+-ATPase 2, SERCA2, 9530097L16Rik, D5Wsu150e, SERCA2B, Serca2a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11938
HGNC: HGNC:812
Homologene: 80167
Mib1
Name: MIB E3 ubiquitin protein ligase 1
Synonyms: E430019M12Rik, Mib, skeletrophin, mind bomb-1, mindbomb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225164
Homologene: 10810
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Cog3
Name: component of oligomeric golgi complex 3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338337
VEGA: 14
Homologene: 5854
Arhgap32
Name: Rho GTPase activating protein 32
Synonyms: p200RhoGAP, GC-GAP, PX-RICS, 3426406O18Rik, Grit
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330914
Homologene: 8812
Rnf123
Name: ring finger protein 123
Synonyms: KPC1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 84585
Homologene: 11112
Asb4
Name: ankyrin repeat and SOCS box-containing 4
Synonyms: 8430401O13Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 65255
Homologene: 9392
Ino80d
Name: INO80 complex subunit D
Synonyms: A430093A21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227195
Homologene: 9819
Dzip3
Name: DAZ interacting protein 3, zinc finger
Synonyms: 6430549P11Rik, 2310047C04Rik, 2A-HUB
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224170
Homologene: 8771
Themis
Name: thymocyte selection associated
Synonyms: E430004N04Rik, Tsepa, Gasp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 210757
Homologene: 72287
Lig4
Name: ligase IV, DNA, ATP-dependent
Synonyms: DNA ligase IV, 5830471N16Rik, tiny
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319583
HGNC: HGNC:6601
Homologene: 1736
Celf2
Name: CUGBP, Elav-like family member 2
Synonyms: Napor-2, ETR-3, B230345P09Rik, Cugbp2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14007
HGNC: HGNC:2550
Homologene: 4783
Unkl
Name: unkempt family like zinc finger
Synonyms: 1300004G08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74154
Homologene: 62673
Zfp280b
Name: zinc finger protein 280B
Synonyms: D10Jhu82e, Suhw2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64453
VEGA: 10
Homologene: 62794
Prf1
Name: perforin 1 (pore forming protein)
Synonyms: perforin, Prf-1, Pfp, Pfn
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18646
VEGA: 10
HGNC: HGNC:9360
Homologene: 3698
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Slc9a5
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 5
Synonyms: LOC277973
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 277973
Homologene: 31247
Agbl1
Name: ATP/GTP binding protein-like 1
Synonyms: Nna1-l1, EG244071, Ccp4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244071
Homologene: 17552
Col7a1
Name: collagen, type VII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12836
HGNC: HGNC:2214
Homologene: 73
Chd3
Name: chromodomain helicase DNA binding protein 3
Synonyms: Mi-2 alpha, Prp9-1, Prp7, 2600010P09Rik, Chd7
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216848
HGNC: HGNC:1918
Homologene: 62693
Emilin2
Name: elastin microfibril interfacer 2
Synonyms: basilin, FOAP-10
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 246707
VEGA: 17
Homologene: 36483
Dner
Name: delta/notch-like EGF repeat containing
Synonyms: BET, A930026D19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227325
Homologene: 26722
Spata31e2
Name: spermatogenesis associated 31 subfamily E member 2
Synonyms: 4931408C20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210940
Homologene: 86827
Zc3h12c
Name: zinc finger CCCH type containing 12C
Synonyms: C230027N18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244871
VEGA: 9
Homologene: 35462
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Pde8a
Name: phosphodiesterase 8A
Synonyms: Pde8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18584
HGNC: HGNC:8793
Homologene: 1957
Pappa
Name: pregnancy-associated plasma protein A
Synonyms: PAG1, IGFBP-4ase, PAPP-A, 8430414N03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18491
HGNC: HGNC:8602
Homologene: 31097
Sfi1
Name: Sfi1 homolog, spindle assembly associated (yeast)
Synonyms: 2310047I15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78887
Homologene: 12707
Elp4
Name: elongator acetyltransferase complex subunit 4
Synonyms: Paxneb, A330107A17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77766
HGNC: HGNC:1171
Homologene: 32433
Col5a1
Name: collagen, type V, alpha 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12831
HGNC: HGNC:2209
Homologene: 55434
Nme4
Name: NME/NM23 nucleoside diphosphate kinase 4
Synonyms: NM23-M4, 5730493H09Rik, 2810024O08Rik, 2610027N22Rik, non-metastatic cells 4, protein expressed in
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56520
HGNC: HGNC:7852
Homologene: 3673
Parp6
Name: poly (ADP-ribose) polymerase family, member 6
Synonyms: 2310028P13Rik, 1700119G14Rik, C030013N01Rik, 3110038K10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67287
VEGA: 9
Homologene: 10627
Large1
Name: LARGE xylosyl- and glucuronyltransferase 1
Synonyms: fg, BPFD#36, froggy, enr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 16795
HGNC: HGNC:6511
Homologene: 7810
Gtf3c4
Name: general transcription factor IIIC, polypeptide 4
Synonyms: KAT12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269252
HGNC: HGNC:4667
Homologene: 8147
Uevld
Name: UEV and lactate/malate dehyrogenase domains
Synonyms: 8430408E05Rik, Attp
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54122
Homologene: 69251
Tubb2a
Name: tubulin, beta 2A class IIA
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 22151
VEGA: 13
Homologene: 134314
Scnn1b
Name: sodium channel, nonvoltage-gated 1 beta
Synonyms: ENaC beta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20277
Homologene: 133555
Tgm1
Name: transglutaminase 1, K polypeptide
Synonyms: protein-glutamine-gamma-glutamyltransferase, K polypeptide, TG K, TGase 1, 2310004J08Rik, TGase1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21816
VEGA: 14
Homologene: 306
Or52s6
Name: olfactory receptor family 52 subfamily S member 6
Synonyms: GA_x6K02T2PBJ9-6164792-6163848, MOR202-22P, MOR24-5, Olfr605
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258156
Homologene: 79414
Dnaaf1
Name: dynein, axonemal assembly factor 1
Synonyms: 4930457P18Rik, Lrrc50, m4Bei
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68270
Homologene: 12256
Eif2b4
Name: eukaryotic translation initiation factor 2B, subunit 4 delta
Synonyms: Eif2b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13667
HGNC: HGNC:3260
Homologene: 5976
Prdm13
Name: PR domain containing 13
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230025
Homologene: 11000
Fstl1
Name: follistatin-like 1
Synonyms: TSC-36
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 14314
HGNC: HGNC:3972
Homologene: 5144
Wee2
Name: WEE1 homolog 2 (S. pombe)
Synonyms: LOC381759, Wee1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381759
Homologene: 52392
Bend4
Name: BEN domain containing 4
Synonyms: EG666938, D330027G24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 666938
Homologene: 52626
Fxn
Name: frataxin
Synonyms: Frda
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14297
HGNC: HGNC:3951
Homologene: 47908
Adam4
Name: a disintegrin and metallopeptidase domain 4
Synonyms: tMDCV
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11498
Homologene: 86950
Sult1c1
Name: sulfotransferase family, cytosolic, 1C, member 1
Synonyms: (PST)G, mOLFST, P-SULT, Stp2, Sult1a2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20888
Homologene: 56817
Ndufaf6
Name: NADH:ubiquinone oxidoreductase complex assembly factor 6
Synonyms: 2310030N02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76947
Homologene: 43831
Crtc3
Name: CREB regulated transcription coactivator 3
Synonyms: 6332415K15Rik, 2610312F20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70461
Homologene: 11248
Kank3
Name: KN motif and ankyrin repeat domains 3
Synonyms: 0610013D04Rik, D17Ertd288e, Ankrd47
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 80880
Homologene: 12749
Or52z15
Name: olfactory receptor family 52 subfamily Z member 15
Synonyms: GA_x6K02T2PBJ9-6416276-6417237, MOR31-15P, Olfr625
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258169
Vmn1r159
Name: vomeronasal 1 receptor 159
Synonyms: Gm16507
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 670857
Homologene: 104166
Zfp354b
Name: zinc finger protein 354B
Synonyms: Kid2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27274
Homologene: 32187
Tnni3
Name: troponin I, cardiac 3
Synonyms: Tn1, cardiac troponin I, cTnI
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21954
Homologene: 309
Slco4a1
Name: solute carrier organic anion transporter family, member 4a1
Synonyms: OATP-E, Slc21a12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108115
Homologene: 9482
Ydjc
Name: YdjC homolog (bacterial)
Synonyms: 4930521M19Rik, 1810015A11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69101
Homologene: 19062
Amot
Name: angiomotin
Synonyms: D0Kist1, E230009N18Rik, Sii6
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 27494
Homologene: 15778
Agpat2
Name: 1-acylglycerol-3-phosphate O-acyltransferase 2
Synonyms: LPAAT-beta, BSCL1, 2510002J07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67512
HGNC: HGNC:325
Homologene: 4678
Rarres1
Name: retinoic acid receptor responder (tazarotene induced) 1
Synonyms: 5430417P09Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109222
HGNC: HGNC:9867
Homologene: 2166
Catspere2
Name: cation channel sperm associated auxiliary subunit epsilon 2
Synonyms: Gm30473, EG545391, Gm16432
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545391
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 26,684,404 bp (GRCm38)
  • A to G, chromosome 1 at 63,093,448 bp (GRCm38)
  • A to T, chromosome 1 at 84,534,926 bp (GRCm38)
  • T to A, chromosome 1 at 178,140,383 bp (GRCm38)
  • A to G, chromosome 2 at 6,549,835 bp (GRCm38)
  • A to T, chromosome 2 at 26,597,218 bp (GRCm38)
  • A to G, chromosome 2 at 27,951,351 bp (GRCm38)
  • A to T, chromosome 2 at 28,840,202 bp (GRCm38)
  • T to A, chromosome 2 at 76,915,568 bp (GRCm38)
  • T to C, chromosome 2 at 105,794,546 bp (GRCm38)
  • A to G, chromosome 2 at 180,464,685 bp (GRCm38)
  • A to G, chromosome 3 at 67,479,591 bp (GRCm38)
  • T to C, chromosome 4 at 11,070,301 bp (GRCm38)
  • C to G, chromosome 4 at 21,679,659 bp (GRCm38)
  • G to A, chromosome 4 at 65,340,725 bp (GRCm38)
  • T to C, chromosome 4 at 143,615,030 bp (GRCm38)
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp (GRCm38)
  • A to G, chromosome 5 at 14,681,054 bp (GRCm38)
  • A to G, chromosome 5 at 31,188,049 bp (GRCm38)
  • A to G, chromosome 5 at 67,417,737 bp (GRCm38)
  • GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC to GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC, chromosome 5 at 77,281,804 bp (GRCm38)
  • C to T, chromosome 5 at 122,466,024 bp (GRCm38)
  • T to A, chromosome 6 at 5,390,775 bp (GRCm38)
  • T to G, chromosome 6 at 40,461,043 bp (GRCm38)
  • A to T, chromosome 7 at 4,518,377 bp (GRCm38)
  • C to A, chromosome 7 at 22,843,340 bp (GRCm38)
  • C to A, chromosome 7 at 46,937,998 bp (GRCm38)
  • T to C, chromosome 7 at 76,335,321 bp (GRCm38)
  • A to T, chromosome 7 at 80,598,949 bp (GRCm38)
  • C to T, chromosome 7 at 81,332,871 bp (GRCm38)
  • G to A, chromosome 7 at 103,442,643 bp (GRCm38)
  • T to A, chromosome 7 at 103,683,197 bp (GRCm38)
  • A to T, chromosome 7 at 121,912,103 bp (GRCm38)
  • C to A, chromosome 8 at 9,972,202 bp (GRCm38)
  • T to A, chromosome 8 at 72,816,017 bp (GRCm38)
  • T to C, chromosome 8 at 105,353,507 bp (GRCm38)
  • T to C, chromosome 8 at 119,575,456 bp (GRCm38)
  • G to A, chromosome 9 at 32,250,743 bp (GRCm38)
  • A to G, chromosome 9 at 52,116,119 bp (GRCm38)
  • A to T, chromosome 9 at 55,026,387 bp (GRCm38)
  • G to A, chromosome 9 at 59,623,930 bp (GRCm38)
  • A to G, chromosome 9 at 108,071,176 bp (GRCm38)
  • A to G, chromosome 9 at 108,956,639 bp (GRCm38)
  • C to A, chromosome 10 at 28,782,237 bp (GRCm38)
  • A to C, chromosome 10 at 61,300,437 bp (GRCm38)
  • T to A, chromosome 10 at 76,038,817 bp (GRCm38)
  • A to ATCTTCCCAAAGCCAGTGC, chromosome 11 at 3,153,384 bp (GRCm38)
  • C to T, chromosome 11 at 50,923,535 bp (GRCm38)
  • T to C, chromosome 11 at 69,350,822 bp (GRCm38)
  • T to C, chromosome 11 at 79,545,465 bp (GRCm38)
  • T to C, chromosome 12 at 81,419,742 bp (GRCm38)
  • T to A, chromosome 13 at 34,076,645 bp (GRCm38)
  • T to C, chromosome 14 at 55,708,898 bp (GRCm38)
  • T to C, chromosome 14 at 75,729,362 bp (GRCm38)
  • T to C, chromosome 16 at 17,147,802 bp (GRCm38)
  • T to A, chromosome 16 at 37,826,778 bp (GRCm38)
  • T to C, chromosome 16 at 48,952,038 bp (GRCm38)
  • T to C, chromosome 17 at 25,229,376 bp (GRCm38)
  • G to T, chromosome 17 at 26,095,415 bp (GRCm38)
  • T to G, chromosome 17 at 33,818,268 bp (GRCm38)
  • T to C, chromosome 17 at 53,962,172 bp (GRCm38)
  • T to A, chromosome 17 at 71,280,694 bp (GRCm38)
  • C to T, chromosome 18 at 10,726,437 bp (GRCm38)
  • A to G, chromosome 19 at 24,267,323 bp (GRCm38)
  • A to T, chromosome X at 145,461,749 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9170 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069026-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.