Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9170Btlr/Mmmh
Stock Number:
069026-MU
Citation ID:
RRID:MMRRC_069026-MU
Other Names:
R9170 (G1)
Major Collection:

Strain Information

Rest
Name: RE1-silencing transcription factor
Synonyms: 2610008J04Rik, NRSF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19712
HGNC: HGNC:9966
Homologene: 4099
Chrna3
Name: cholinergic receptor, nicotinic, alpha polypeptide 3
Synonyms: (a)3, alpha 3, neuronal nicotinic acetylcholine receptor, alpha 3 subunit, Acra-3, Acra3, A730007P14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110834
VEGA: 9
HGNC: HGNC:1957
Homologene: 591
Atp2a2
Name: ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Synonyms: sarco/endoplasmic reticulum Ca2+-ATPase 2, SERCA2, 9530097L16Rik, D5Wsu150e, SERCA2B, Serca2a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11938
HGNC: HGNC:812
Homologene: 80167
Mib1
Name: MIB E3 ubiquitin protein ligase 1
Synonyms: E430019M12Rik, Mib, skeletrophin, mind bomb-1, mindbomb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225164
Homologene: 10810
Nf1
Name: neurofibromin 1
Synonyms: neurofibromin, Nf-1, Dsk9, Mhdadsk9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18015
HGNC: HGNC:7765
Homologene: 226
Cog3
Name: component of oligomeric golgi complex 3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 338337
VEGA: 14
Homologene: 5854
Arhgap32
Name: Rho GTPase activating protein 32
Synonyms: p200RhoGAP, GC-GAP, PX-RICS, 3426406O18Rik, Grit
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330914
Homologene: 8812
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 26,684,404 bp (GRCm38)
  • A to G, chromosome 1 at 63,093,448 bp (GRCm38)
  • A to T, chromosome 1 at 84,534,926 bp (GRCm38)
  • T to A, chromosome 1 at 178,140,383 bp (GRCm38)
  • A to G, chromosome 2 at 6,549,835 bp (GRCm38)
  • A to T, chromosome 2 at 26,597,218 bp (GRCm38)
  • A to G, chromosome 2 at 27,951,351 bp (GRCm38)
  • A to T, chromosome 2 at 28,840,202 bp (GRCm38)
  • T to A, chromosome 2 at 76,915,568 bp (GRCm38)
  • T to C, chromosome 2 at 105,794,546 bp (GRCm38)
  • A to G, chromosome 2 at 180,464,685 bp (GRCm38)
  • A to G, chromosome 3 at 67,479,591 bp (GRCm38)
  • T to C, chromosome 4 at 11,070,301 bp (GRCm38)
  • C to G, chromosome 4 at 21,679,659 bp (GRCm38)
  • G to A, chromosome 4 at 65,340,725 bp (GRCm38)
  • T to C, chromosome 4 at 143,615,030 bp (GRCm38)
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp (GRCm38)
  • A to G, chromosome 5 at 14,681,054 bp (GRCm38)
  • A to G, chromosome 5 at 31,188,049 bp (GRCm38)
  • A to G, chromosome 5 at 67,417,737 bp (GRCm38)
  • GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC to GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC, chromosome 5 at 77,281,804 bp (GRCm38)
  • C to T, chromosome 5 at 122,466,024 bp (GRCm38)
  • T to A, chromosome 6 at 5,390,775 bp (GRCm38)
  • T to G, chromosome 6 at 40,461,043 bp (GRCm38)
  • A to T, chromosome 7 at 4,518,377 bp (GRCm38)
  • C to A, chromosome 7 at 22,843,340 bp (GRCm38)
  • C to A, chromosome 7 at 46,937,998 bp (GRCm38)
  • T to C, chromosome 7 at 76,335,321 bp (GRCm38)
  • A to T, chromosome 7 at 80,598,949 bp (GRCm38)
  • C to T, chromosome 7 at 81,332,871 bp (GRCm38)
  • G to A, chromosome 7 at 103,442,643 bp (GRCm38)
  • T to A, chromosome 7 at 103,683,197 bp (GRCm38)
  • A to T, chromosome 7 at 121,912,103 bp (GRCm38)
  • C to A, chromosome 8 at 9,972,202 bp (GRCm38)
  • T to A, chromosome 8 at 72,816,017 bp (GRCm38)
  • T to C, chromosome 8 at 105,353,507 bp (GRCm38)
  • T to C, chromosome 8 at 119,575,456 bp (GRCm38)
  • G to A, chromosome 9 at 32,250,743 bp (GRCm38)
  • A to G, chromosome 9 at 52,116,119 bp (GRCm38)
  • A to T, chromosome 9 at 55,026,387 bp (GRCm38)
  • G to A, chromosome 9 at 59,623,930 bp (GRCm38)
  • A to G, chromosome 9 at 108,071,176 bp (GRCm38)
  • A to G, chromosome 9 at 108,956,639 bp (GRCm38)
  • C to A, chromosome 10 at 28,782,237 bp (GRCm38)
  • A to C, chromosome 10 at 61,300,437 bp (GRCm38)
  • T to A, chromosome 10 at 76,038,817 bp (GRCm38)
  • A to ATCTTCCCAAAGCCAGTGC, chromosome 11 at 3,153,384 bp (GRCm38)
  • C to T, chromosome 11 at 50,923,535 bp (GRCm38)
  • T to C, chromosome 11 at 69,350,822 bp (GRCm38)
  • T to C, chromosome 11 at 79,545,465 bp (GRCm38)
  • T to C, chromosome 12 at 81,419,742 bp (GRCm38)
  • T to A, chromosome 13 at 34,076,645 bp (GRCm38)
  • T to C, chromosome 14 at 55,708,898 bp (GRCm38)
  • T to C, chromosome 14 at 75,729,362 bp (GRCm38)
  • T to C, chromosome 16 at 17,147,802 bp (GRCm38)
  • T to A, chromosome 16 at 37,826,778 bp (GRCm38)
  • T to C, chromosome 16 at 48,952,038 bp (GRCm38)
  • T to C, chromosome 17 at 25,229,376 bp (GRCm38)
  • G to T, chromosome 17 at 26,095,415 bp (GRCm38)
  • T to G, chromosome 17 at 33,818,268 bp (GRCm38)
  • T to C, chromosome 17 at 53,962,172 bp (GRCm38)
  • T to A, chromosome 17 at 71,280,694 bp (GRCm38)
  • C to T, chromosome 18 at 10,726,437 bp (GRCm38)
  • A to G, chromosome 19 at 24,267,323 bp (GRCm38)
  • A to T, chromosome X at 145,461,749 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9170 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069026-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.