Strain Name:
C57BL/6J-MtgxR9172Btlr/Mmmh
Stock Number:
069027-MU
Citation ID:
RRID:MMRRC_069027-MU
Other Names:
R9172 (G1)
Major Collection:

Strain Information

Strap
Name: serine/threonine kinase receptor associated protein
Synonyms: Unrip, C78091
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20901
Homologene: 43881
Vps33a
Name: VPS33A CORVET/HOPS core subunit
Synonyms: 3830421M04Rik, bf
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77573
Homologene: 11294
Vcan
Name: versican
Synonyms: heart defect, 5430420N07Rik, DPEAAE, PG-M, Cspg2, hdf
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Pzp
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Rnf145
Name: ring finger protein 145
Synonyms: 3732413I11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74315
Homologene: 14427
Mbtps1
Name: membrane-bound transcription factor peptidase, site 1
Synonyms: S1P, SKI-1, 0610038M03Rik, site-1 protease, subtilisin/kexin isozyme-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56453
Homologene: 2808
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, Lphn3, 5430402I23Rik, LEC3, D130075K09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Nkx2-1
Name: NK2 homeobox 1
Synonyms: thyroid transcription factor-1, tinman, Titf1, thyroid-specific enhancer-binding protein, T/EBP, Ttf-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 21869
Homologene: 2488
Btaf1
Name: B-TFIID TATA-box binding protein associated factor 1
Synonyms: E430027O22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107182
Homologene: 31978
Fry
Name: FRY microtubule binding protein
Synonyms: 9330186A19Rik, cg003
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Tyw1
Name: tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)
Synonyms: Rsafd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100929
Homologene: 7068
Ppfibp2
Name: PTPRF interacting protein, binding protein 2 (liprin beta 2)
Synonyms: liprin beta 2, Cclp1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19024
HGNC: HGNC:9250
Homologene: 7486
Med4
Name: mediator complex subunit 4
Synonyms: Vdrip, HSPC126, p36 TRAP/SMCC/PC2 subunit, TRAP36, MED4, 2410046H15Rik, DRIP36
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67381
VEGA: 14
Homologene: 8568
Opa1
Name: OPA1, mitochondrial dynamin like GTPase
Synonyms: lilr3, 1200011N24Rik, optic atrophy 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74143
HGNC: HGNC:8140
Homologene: 14618
Atp9b
Name: ATPase, class II, type 9B
Synonyms: IIb
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 50771
VEGA: 18
Homologene: 21915
Opa3
Name: optic atrophy 3
Synonyms: LOC243868, D630048P19Rik, LOC384570
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 403187
HGNC: HGNC:8142
Homologene: 57022
Sec23b
Name: SEC23 homolog B, COPII coat complex component
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27054
Homologene: 74571
Pygo2
Name: pygopus 2
Synonyms: mpygo2, 1190004M21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68911
Homologene: 44519
Sox11
Name: SRY (sex determining region Y)-box 11
Synonyms: 6230403H02Rik, end1, 1110038H03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20666
Homologene: 37733
Adcy1
Name: adenylate cyclase 1
Synonyms: AC1, D11Bwg1392e, I-AC
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432530
HGNC: HGNC:232
Homologene: 41419
Erc1
Name: ELKS/RAB6-interacting/CAST family member 1
Synonyms: B430107L16Rik, 5033405M01Rik, 9630025C19Rik, Rab6ip2, RAB6IP2B, RAB6IP2A, Elks1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 111173
Homologene: 14229
Rmdn3
Name: regulator of microtubule dynamics 3
Synonyms: Fam82a2, 1200015F23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67809
Homologene: 34926
Zfp12
Name: zinc finger protein 12
Synonyms: Krox-7, Zfp-12
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231866
Homologene: 65328
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, Dnchc2, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, m407Asp, m152Asp, b2b414Clo
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Kif24
Name: kinesin family member 24
Synonyms: 4933425J19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 109242
Homologene: 52346
Gca
Name: grancalcin
Synonyms: 5133401E04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227960
Homologene: 22702
Slc39a6
Name: solute carrier family 39 (metal ion transporter), member 6
Synonyms: Ermelin, Zip6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106957
Homologene: 8199
Vtcn1
Name: V-set domain containing T cell activation inhibitor 1
Synonyms: B7x, B7-H4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242122
Homologene: 11627
Nbas
Name: neuroblastoma amplified sequence
Synonyms: 4933425L03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71169
VEGA: 12
Homologene: 41073
Myo7a
Name: myosin VIIA
Synonyms: nmf371, Hdb, polka, USH1B, Myo7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17921
HGNC: HGNC:7606
Homologene: 219
Tek
Name: TEK receptor tyrosine kinase
Synonyms: tie-2, Cd202b, Tie2, Hyk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21687
Homologene: 397
Fcsk
Name: fucose kinase
Synonyms: L-fucose kinase, 1110046B12Rik, Fuk
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234730
Homologene: 15452
Dnai7
Name: dynein axonemal intermediate chain 7
Synonyms: A230084G12Rik, Las1, Casc1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320662
Homologene: 41242
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: Myhsp, Myhs-p, MyHC-pn, 4832426G23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Mroh4
Name: maestro heat-like repeat family member 4
Synonyms: 1700016M24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69439
Homologene: 72545
Vmn2r3
Name: vomeronasal 2, receptor 3
Synonyms: EG637004
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 637004
Stxbp5
Name: syntaxin binding protein 5 (tomosyn)
Synonyms: tomosyn 1, LGL3, 0710001E20Rik, 4930565N16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78808
Homologene: 16402
Npas3
Name: neuronal PAS domain protein 3
Synonyms: bHLHe12, 4930423H22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 27386
VEGA: 12
Homologene: 8461
Cpd
Name: carboxypeptidase D
Synonyms: D830034L15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12874
HGNC: HGNC:2301
Homologene: 999
Grin2b
Name: glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms: NMDAR2B, GluRepsilon2, Nmdar2b, GluN2B, NR2B
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14812
HGNC: HGNC:4586
Homologene: 646
Mybpc1
Name: myosin binding protein C, slow-type
Synonyms: Slow-type C-protein, 8030451F13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 109272
HGNC: HGNC:7549
Homologene: 1846
Semp2l1
Name: SUMO/sentrin specific peptidase 2-like 1
Synonyms: Gm5415
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 408191
Homologene: 130042
Or8k38
Name: olfactory receptor family 8 subfamily K member 38
Synonyms: GA_x6K02T2Q125-48147264-48146323, Olfr1085, MOR191-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258583
Or5p63
Name: olfactory receptor family 5 subfamily P member 63
Synonyms: MOR204-31P, Olfr487, MOR204-31P, MOR204-29P, GA_x6K02T2PBJ9-10541702-10540758, Olfr1538-ps1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258042
Homologene: 110483
Fbxw21
Name: F-box and WD-40 domain protein 21
Synonyms: E330009P21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320082
Homologene: 110776
Alyref
Name: Aly/REF export factor
Synonyms: Thoc4, Refbp1, REF1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21681
Homologene: 38099
Arhgap26
Name: Rho GTPase activating protein 26
Synonyms: 1810044B20Rik, 4933432P15Rik, 2610010G17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 71302
Homologene: 36349
Accsl
Name: 1-aminocyclopropane-1-carboxylate synthase (inactive)-like
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381411
Homologene: 86007
Vmn2r24
Name: vomeronasal 2, receptor 24
Synonyms: EG243628
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243628
Homologene: 135915
Taar7a
Name: trace amine-associated receptor 7A
Synonyms: LOC215856, Taar7a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215856
Homologene: 110833
Spata31e3
Name: spermatogenesis associated 31 subfamily E member 3
Synonyms: LOC380882, Gm906
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 380882
VEGA: 13
Homologene: 134512
Ctsm
Name: cathepsin M
Synonyms: Cat M, 1600027J17Rik, Catm
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 64139
VEGA: 13
Homologene: 75181
Ripor1
Name: RHO family interacting cell polarization regulator 1
Synonyms: 2310066E14Rik, Fam65a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75687
Homologene: 11564
Cry2
Name: cryptochrome circadian regulator 2
Synonyms: D130054K12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12953
HGNC: HGNC:2385
Homologene: 56466
Gimap7
Name: GTPase, IMAP family member 7
Synonyms: Ian3, IAN7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 231932
Homologene: 134307
Zfp324
Name: zinc finger protein 324
Synonyms: ZF5128, D430030K24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243834
Homologene: 8648
Commd7
Name: COMM domain containing 7
Synonyms: 2310010I22Rik, mU3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99311
Homologene: 24933
Zfp263
Name: zinc finger protein 263
Synonyms: mFPM315, NT2, 1200014J04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74120
Homologene: 4197
Cmtr2
Name: cap methyltransferase 2
Synonyms: C730036L12Rik, Ftsjd1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234728
Homologene: 10144
Zfp747l1
Name: zinc finger protein 747 like 1
Synonyms: 9130019O22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78921
Homologene: 118005
Mgat1
Name: mannoside acetylglucosaminyltransferase 1
Synonyms: Mgat-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17308
HGNC: HGNC:7044
Homologene: 1804
Vta1
Name: vesicle (multivesicular body) trafficking 1
Synonyms: 1110059P08Rik, 1110001D18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66201
Homologene: 6473
Zscan4c
Name: zinc finger and SCAN domain containing 4C
Synonyms: LOC245109
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 245109
Homologene: 85986
Gm9195
Name: predicted gene 9195
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 675947
Homologene: 139067
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to T, chromosome 1 at 32,546,084 bp (GRCm38)
  • T to G, chromosome 2 at 62,690,024 bp (GRCm38)
  • T to A, chromosome 2 at 86,657,535 bp (GRCm38)
  • C to A, chromosome 2 at 92,413,648 bp (GRCm38)
  • A to T, chromosome 2 at 93,861,488 bp (GRCm38)
  • T to C, chromosome 2 at 119,138,382 bp (GRCm38)
  • A to T, chromosome 2 at 144,559,259 bp (GRCm38)
  • A to T, chromosome 2 at 153,628,554 bp (GRCm38)
  • T to A, chromosome 3 at 55,124,846 bp (GRCm38)
  • A to T, chromosome 3 at 64,278,982 bp (GRCm38)
  • T to A, chromosome 3 at 89,433,310 bp (GRCm38)
  • A to G, chromosome 3 at 100,892,549 bp (GRCm38)
  • T to C, chromosome 4 at 41,400,442 bp (GRCm38)
  • T to A, chromosome 4 at 94,804,346 bp (GRCm38)
  • A to G, chromosome 5 at 21,950,817 bp (GRCm38)
  • T to A, chromosome 5 at 81,774,404 bp (GRCm38)
  • T to C, chromosome 5 at 123,536,541 bp (GRCm38)
  • T to A, chromosome 5 at 130,296,679 bp (GRCm38)
  • T to A, chromosome 5 at 143,245,465 bp (GRCm38)
  • T to C, chromosome 5 at 150,413,328 bp (GRCm38)
  • A to T, chromosome 6 at 48,723,827 bp (GRCm38)
  • A to C, chromosome 6 at 119,824,881 bp (GRCm38)
  • A to G, chromosome 6 at 123,806,473 bp (GRCm38)
  • A to T, chromosome 6 at 128,525,209 bp (GRCm38)
  • A to G, chromosome 6 at 135,779,257 bp (GRCm38)
  • A to T, chromosome 6 at 137,741,367 bp (GRCm38)
  • A to G, chromosome 6 at 145,177,449 bp (GRCm38)
  • A to T, chromosome 7 at 11,009,892 bp (GRCm38)
  • T to A, chromosome 7 at 12,970,762 bp (GRCm38)
  • C to T, chromosome 7 at 19,255,541 bp (GRCm38)
  • T to C, chromosome 7 at 98,083,162 bp (GRCm38)
  • T to A, chromosome 7 at 107,738,318 bp (GRCm38)
  • T to C, chromosome 7 at 108,211,962 bp (GRCm38)
  • T to C, chromosome 7 at 127,385,454 bp (GRCm38)
  • ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,710 bp (GRCm38)
  • A to G, chromosome 8 at 105,621,201 bp (GRCm38)
  • T to C, chromosome 8 at 110,222,129 bp (GRCm38)
  • A to G, chromosome 8 at 110,883,925 bp (GRCm38)
  • G to A, chromosome 8 at 119,533,369 bp (GRCm38)
  • T to C, chromosome 9 at 7,031,771 bp (GRCm38)
  • T to C, chromosome 9 at 109,146,696 bp (GRCm38)
  • T to A, chromosome 10 at 9,769,408 bp (GRCm38)
  • A to G, chromosome 10 at 14,675,999 bp (GRCm38)
  • T to C, chromosome 10 at 23,992,779 bp (GRCm38)
  • T to C, chromosome 10 at 88,543,753 bp (GRCm38)
  • A to G, chromosome 11 at 7,160,317 bp (GRCm38)
  • A to G, chromosome 11 at 44,557,435 bp (GRCm38)
  • G to A, chromosome 11 at 49,261,083 bp (GRCm38)
  • C to T, chromosome 11 at 67,292,434 bp (GRCm38)
  • T to A, chromosome 11 at 76,784,426 bp (GRCm38)
  • G to A, chromosome 11 at 120,596,016 bp (GRCm38)
  • T to A, chromosome 12 at 13,374,750 bp (GRCm38)
  • G to A, chromosome 12 at 27,341,537 bp (GRCm38)
  • A to G, chromosome 12 at 54,065,870 bp (GRCm38)
  • C to A, chromosome 12 at 56,534,967 bp (GRCm38)
  • A to G, chromosome 13 at 50,247,381 bp (GRCm38)
  • A to T, chromosome 13 at 61,537,829 bp (GRCm38)
  • T to C, chromosome 13 at 89,679,931 bp (GRCm38)
  • A to C, chromosome 14 at 72,473,714 bp (GRCm38)
  • A to T, chromosome 14 at 73,513,925 bp (GRCm38)
  • T to C, chromosome 15 at 74,606,112 bp (GRCm38)
  • A to G, chromosome 16 at 3,749,459 bp (GRCm38)
  • C to T, chromosome 16 at 29,620,414 bp (GRCm38)
  • A to G, chromosome 18 at 24,582,342 bp (GRCm38)
  • A to T, chromosome 18 at 39,245,329 bp (GRCm38)
  • G to A, chromosome 18 at 80,917,778 bp (GRCm38)
  • G to A, chromosome 19 at 37,000,230 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9172 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069027-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.