Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9172Btlr/Mmmh
Stock Number:
069027-MU
Citation ID:
RRID:MMRRC_069027-MU
Other Names:
R9172 (G1)
Major Collection:

Strain Information

Strap
Name: serine/threonine kinase receptor associated protein
Synonyms: C78091, Unrip
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20901
Homologene: 43881
Vps33a
Name: VPS33A CORVET/HOPS core subunit
Synonyms: bf, 3830421M04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 77573
Homologene: 11294
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Pzp
Name: PZP, alpha-2-macroglobulin like
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11287
Homologene: 104112
Rnf145
Name: ring finger protein 145
Synonyms: 3732413I11Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74315
Homologene: 14427
Mbtps1
Name: membrane-bound transcription factor peptidase, site 1
Synonyms: subtilisin/kexin isozyme-1, SKI-1, S1P, 0610038M03Rik, site-1 protease
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56453
Homologene: 2808
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • G to T, chromosome 1 at 32,546,084 bp (GRCm38)
  • T to G, chromosome 2 at 62,690,024 bp (GRCm38)
  • T to A, chromosome 2 at 86,657,535 bp (GRCm38)
  • C to A, chromosome 2 at 92,413,648 bp (GRCm38)
  • A to T, chromosome 2 at 93,861,488 bp (GRCm38)
  • T to C, chromosome 2 at 119,138,382 bp (GRCm38)
  • A to T, chromosome 2 at 144,559,259 bp (GRCm38)
  • A to T, chromosome 2 at 153,628,554 bp (GRCm38)
  • T to A, chromosome 3 at 55,124,846 bp (GRCm38)
  • A to T, chromosome 3 at 64,278,982 bp (GRCm38)
  • T to A, chromosome 3 at 89,433,310 bp (GRCm38)
  • A to G, chromosome 3 at 100,892,549 bp (GRCm38)
  • T to C, chromosome 4 at 41,400,442 bp (GRCm38)
  • T to A, chromosome 4 at 94,804,346 bp (GRCm38)
  • A to G, chromosome 5 at 21,950,817 bp (GRCm38)
  • T to A, chromosome 5 at 81,774,404 bp (GRCm38)
  • T to C, chromosome 5 at 123,536,541 bp (GRCm38)
  • T to A, chromosome 5 at 130,296,679 bp (GRCm38)
  • T to A, chromosome 5 at 143,245,465 bp (GRCm38)
  • T to C, chromosome 5 at 150,413,328 bp (GRCm38)
  • A to T, chromosome 6 at 48,723,827 bp (GRCm38)
  • A to C, chromosome 6 at 119,824,881 bp (GRCm38)
  • A to G, chromosome 6 at 123,806,473 bp (GRCm38)
  • A to T, chromosome 6 at 128,525,209 bp (GRCm38)
  • A to G, chromosome 6 at 135,779,257 bp (GRCm38)
  • A to T, chromosome 6 at 137,741,367 bp (GRCm38)
  • A to G, chromosome 6 at 145,177,449 bp (GRCm38)
  • A to T, chromosome 7 at 11,009,892 bp (GRCm38)
  • T to A, chromosome 7 at 12,970,762 bp (GRCm38)
  • C to T, chromosome 7 at 19,255,541 bp (GRCm38)
  • T to C, chromosome 7 at 98,083,162 bp (GRCm38)
  • T to A, chromosome 7 at 107,738,318 bp (GRCm38)
  • T to C, chromosome 7 at 108,211,962 bp (GRCm38)
  • T to C, chromosome 7 at 127,385,454 bp (GRCm38)
  • ACAACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,710 bp (GRCm38)
  • A to G, chromosome 8 at 105,621,201 bp (GRCm38)
  • T to C, chromosome 8 at 110,222,129 bp (GRCm38)
  • A to G, chromosome 8 at 110,883,925 bp (GRCm38)
  • G to A, chromosome 8 at 119,533,369 bp (GRCm38)
  • T to C, chromosome 9 at 7,031,771 bp (GRCm38)
  • T to C, chromosome 9 at 109,146,696 bp (GRCm38)
  • T to A, chromosome 10 at 9,769,408 bp (GRCm38)
  • A to G, chromosome 10 at 14,675,999 bp (GRCm38)
  • T to C, chromosome 10 at 23,992,779 bp (GRCm38)
  • T to C, chromosome 10 at 88,543,753 bp (GRCm38)
  • A to G, chromosome 11 at 7,160,317 bp (GRCm38)
  • A to G, chromosome 11 at 44,557,435 bp (GRCm38)
  • G to A, chromosome 11 at 49,261,083 bp (GRCm38)
  • C to T, chromosome 11 at 67,292,434 bp (GRCm38)
  • T to A, chromosome 11 at 76,784,426 bp (GRCm38)
  • G to A, chromosome 11 at 120,596,016 bp (GRCm38)
  • T to A, chromosome 12 at 13,374,750 bp (GRCm38)
  • G to A, chromosome 12 at 27,341,537 bp (GRCm38)
  • A to G, chromosome 12 at 54,065,870 bp (GRCm38)
  • C to A, chromosome 12 at 56,534,967 bp (GRCm38)
  • A to G, chromosome 13 at 50,247,381 bp (GRCm38)
  • A to T, chromosome 13 at 61,537,829 bp (GRCm38)
  • T to C, chromosome 13 at 89,679,931 bp (GRCm38)
  • A to C, chromosome 14 at 72,473,714 bp (GRCm38)
  • A to T, chromosome 14 at 73,513,925 bp (GRCm38)
  • T to C, chromosome 15 at 74,606,112 bp (GRCm38)
  • A to G, chromosome 16 at 3,749,459 bp (GRCm38)
  • C to T, chromosome 16 at 29,620,414 bp (GRCm38)
  • A to G, chromosome 18 at 24,582,342 bp (GRCm38)
  • A to T, chromosome 18 at 39,245,329 bp (GRCm38)
  • G to A, chromosome 18 at 80,917,778 bp (GRCm38)
  • G to A, chromosome 19 at 37,000,230 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9172 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069027-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.